Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CWP2
Systematic Name YKL096W-A
Alias LPR1, YKL097W-A
Strain S288c
Description Covalently linked cell wall mannoprotein, major constituent of the cell wall; plays a role in stabilizing the cell wall; involved in low pH resistance; precursor is GPI-anchored
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CWP2 YKL096W-A
CTAATAGACAAGGTGCTATGAGTGAATTGCTAGCCTCCCCTTTTTATTTTGTGCGGTCAC
CGCAAGGGACAAAGCTTTTCTTAGAAAACCGTCTGAGAAGCATAACGTACGCCATCCCCT
AGACATATTAATAATGCTACAGATACTATGCTGCTCGTCTTTTTTTGACGACCCTTTTAT
TGCAATGTGCAACTAATGGCAAACAACCACATAGTATCACAGTATTACATTGCCTCCACC
GATGCGGATGTTAGGGCGCCAAGTCTGTCATGAAGCATGTTCCTGTCATAATCTTGTATG
CAAAATACCGCGTTCTGCGCCACTGATATGCTAGGCAGCAGCAACCTATGCAGAAGATTG
CTTTTCCCACGCCTGTTTTACGTCTCCAGGGCACTTGAAACAATGCAGCGATCGCCGCCA
CAACACGCCAAAGAGAAGCGAAAGTGGGCCTGGGCGGCCTCAGTTTCGGCAGAGGTAAAC
AACACGAACTGAACTGCCTTAGCTCCGAAGGGCAATTCCACAGGCACTCCGCGGGGCCCG
GCCAAGGCCCAAAAGGCGTGGAATATGCGCGTTTTGGGGCCATAACACCCAGTACCACGG
CCGGAACGGGCCATATAATAAGTTTTTCACTCTCAAGAATGGTAAACGTAAATAGGAACA
TCCCACTACCCTAGAAATTGCGGAAATTTCGCGCTTATCATTAGAAAATCTGGAACCGTC
CTTTTTCCTCTTTCTTGCATTTCCCTTTCCGTATTATTGCCATTCTTTAACTGCATTTGG
GGAACCGTAGACCAAAAGCCAAACAGAGAAATGTAACGTTCTAAAAAAAAAACAACGAAA
AAATTGAAAAATAAGATACAATAATCGTATATAAATCAGGCTTCTTGTTCATCATTTTCA
ATTCTCTTCTTGCCATCCCTTTTCCTATCTTTGTTCTTTTCTTCTCATAATCAAGAATAA
ATAACTTCATCACATTCGCTACACACTAACAAGAAAAAAA
Chr coordinates Chr XI from 259253-259531
w3c xhtml validator w3c css validator