Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name UTP11
Systematic Name YKL099C
Strain S288c
Description Subunit of U3-containing Small Subunit (SSU) processome complex; involved in production of 18S rRNA and assembly of small ribosomal subunit
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UTP11 YKL099C
GAATATACCGTCTTACAGTGGACCCCACAAATACATCGTTCAGATTTGCCTCTTCATTTA
ATATGATCGACCTCTTGCTCTCTGGCTCCTGCTTCTCTTCCTCAGCCATACCAATGCTAT
TATTGGCTCTTGTATTAATGCTAGACTCAGTTGAACTTTCAAAATCCAAATATGGGGGTG
CACATGCAAACCAGAATTTGTGTTTGAGCCAAGCGCCCATACGGAAAGACGTGGGCAGGA
AGATGCGAGTTTTGGGAGCTGGTTTACCTGCTTCATCCCCATCCTTAGCGGCGCCTGAAG
GCTGCACGGGATTATTCCAATGAACCACTCCTATAAATATACGTGTTGACTGTGCCTTCT
CAATCGCCACTGTGCAATCTCTCATAATTTTTACTAATTTCGCTTGGTCTGGCTGTAAAA
GAGAATTTATGTCTGGAATGATAACAATCTCAAATTCCTTAACATGTGTAGTTGCTAACG
AGTCCAAGCTTGCAGTTGTTGAGTTCAGAACCGTGACCTTTATTCCTCCGCCCGGATAAG
CGTCATTGATTGCCCTCTTCAGTTGTATATCACAAGTACTTGGCATCGAAGAGGCTAATT
TTTCCTTTGAGACGCTGTCTCTATACATACATAGAAAGCTCTTTTTAGCTGTAACAGAAA
ACTTCAAACATGTCTGAAAATCCGGCAGATTATGATCGCCCATTCCTATTTTTGCCACAT
CCAATCAATAATTTTGCAGCTCCGATTTTGCAGGTGTTGCTGTTCAATGGAAGTAATCGT
TGTTATAAAGGAGCACATCACCAAGTCCTCTAAGGCTTAAAGGTTTGTCGTTATGCACGT
AAAAGATGAAATTTTTTTATGGCTAGATGAGCTCATCGCGATTTGAAGAAAAAGAGTAAA
GAAAACAATGCTAAGAAACTACAATAAGAGCAAGTTGCATATCATCGAATAATACTAGTG
GGGTTTTCTAGTTCGTTACAGCCAACAACAGACAAAAGAT
Chr coordinates Chr XI from 256472-255720
w3c xhtml validator w3c css validator