Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YKL102C
Systematic Name YKL102C
Strain S288c
Description Dubious open reading frame unlikely to encode a functional protein; deletion confers sensitivity to citric acid; predicted protein would include a thiol-disulfide oxidoreductase active site
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YKL102C	6322747 upstream sequence, from -1000 to -1, size 1000
GTTCTCTAGATGCTATTGATGGAGAAGATACATTGGAAGTGACCATGGAAGAAGAGTAAG
AATTAGGAACAGTTCCATTATTAGAACAATGAACAAAGGCTTTCTTCTTGGGGACAATTT
TAATGGCAGCTAATTGTCCTGTTTCCATATTTTTAGCCAAGCGAACCCTACCAGAAGATC
CCTTCCCCAATGTTTTGCCAAGTTTCCAAGGACCCACCGTGTCTCTGGATTTTCTCTTTG
ATGATTTTGTAGCAACACTTACGGTAGAGTCGGGCTGAGATAATCTTTTGGTAGCGTCGT
TCACAGATTGTACAACACGCTCCAAATGCCCCGACGCCCTTTTTGGATTCGAATTTACTT
TGGCCATGGCCCTTTTAGCTGCCTTCTTGGCCAATGAAGACGGGCGACCTTTGGGTACGT
GGCTCGTTTTTGAAACGTGACCAGTCATGTCGTGTGGTAAAAATAAAAAATATTAATAAC
AAATAATAAAGGAGTGAATATAGTTGGTTGTTGATTTATTTATCAGTATTTTTTGTCCCG
CAAATCTATGTCGTTCTTTTTACCTTGTCTTTCTTGTAATTTTATTATTTATCTCTTTTC
GCGATTAGTAGCAAGTAGTATGATGGATATCCAACCTATTTGATGATCTATTTGAGTTCA
ACTCTCTGTTTTAATGGCCTCTCGCTGTCCAATTTACGTCCTTGCAGTCGGATAACTAGC
GAACTTACGATCCAAAGGGAGTTTTAAGAAGAAACAGGTTTCGAGCAAAAGGTAACTTGC
TTATATTAAGAACGCCAATAAGAGTGGCCACTATAATGCTGCTCCCAGCCGGTACAAGAC
GGTACGGTACGTGATGGAGATTAGTTTTCACTATTTAGCCCAAACAACCCAACGCGAAAA
TGACCACGCGAAAAGAAAAATTAGTAAAAATATTTCACAACGCGAAAAATAAGGACGAAG
GCAACACATTCCACCTTCCCTGTTATTGTAAAACGCACAA
Chr coordinates
w3c xhtml validator w3c css validator