Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SEG2
Systematic Name YKL105C
Strain S288c
Description Putative protein of unknown function; similar to A. gossypii SEG gene which is important for stabilizing eisosomes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEG2 YKL105C
GCATTCTGAAGGTGTTTTGGCAGGTGAGTTGAAGCACGGTGTCTTGGCCTTGGTGGACGA
AAACTTGCCAATCATTGCTTTTGGTACCAGAGACTCTCTATTCCCTAAAGTAGTTTCCTC
TATTGAGCAAGTTACTGCAAGAAAGGGCCATCCAATTATTATTTGTAACGAAAATGATGA
AGTGTGGGCGCAAAAATCTAAATCAATCGACCTGCAAACCTTAGAAGTTCCACAAACTGT
TGATTGTTTACAAGGTCTAATTAATATTATTCCATTACAACTAATGTCATATTGGTTGGC
TGTTAATAAAGGGATTGATGTTGATTTTCCAAGAAACTTGGCTAAATCTGTTACCGTCGA
ATAAATTAACCCTTTTACTTTCTCTTCGTCCCCCAGCCTCCCATCCGTCTTTCTACTATC
ACTTCTCCTTCGCTTTTAATTTTTGAACTTCCATTATTCTGCAATGCGCACTACAAGCTG
GCGTTAAAGATGATTCCACTTGTATTCTCTATATAAATAAAAAATTATATTTTATATGAA
TAACCAAAAAGATAGTTGCAGCCCTAAATTAGACCTGCTAAATAAATGTGTTCTAACTTT
GTTACAATTTTTAAACCATATAACTTCCTTCTTGTAAGTCCTCTAAAATAATATTAAACC
CTATCCTGAGTTGGGCCCTGCGTTTTACCCGCAGGAATAGGCCCGATGATTGATTATCCA
CATCAACTTTTGGTGAAATTCGAGAGAAAATAAATGGGAAGTGAACGAGCAATAGGCAAT
CAACAAAAAAAAAAAAGGGTTAGGAAATTCGCTATTGTAAAGAGGCAATTTTTAAAATTT
AGAGTGAAAATCGCCATTCCATCTTCTTCATATTCTTCGTTCAAATTACACAATTATTGC
GGGAGGAAATAGCATTTATTAACCCTAATAATCAACATAAGGCAGATAGCTCTGAAAGAG
GCAAGTATCAACAAATAGTGGGAGCATTGGAAATAGCGGG
Chr coordinates Chr XI from 242583-239185
w3c xhtml validator w3c css validator