Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AAT1
Systematic Name YKL106W
Strain S288c
Description Mitochondrial aspartate aminotransferase, catalyzes the conversion of oxaloacetate to aspartate in aspartate and asparagine biosynthesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AAT1 YKL106W
TGTGGCGAAGCGATTAGGAATTAGTAGGACAAAAAAAGACGATTTGCCAAAAGTTTTCAT
AGCAGGGTTTCCAGGAAATGGTCAGGTGGGAGACCCAGATGACTTGAATTCTGATGAAAA
GAAGTATAGTGCCTACGCTACACATATGAACACTGTGGCAGCCAATGAAAGTCTGGTCAT
AGACGCTAAAGACAGATACACGAATATAGATACTTTCGGTTTGAACCCTGGGCTGATCAA
AACGAACATTCGTAATAATCTTCTTGGCAGTGACACCTACCTCAGCCGCATTACAGAATG
GATAATCAGCTGGACCTGTCAAAGCGCAGAGACGTATGCGAAAACAATATGCACCCTGAT
TGCGAGCCCCGCTATCGAATCACGCAGTGGTACAATGTTCAGCAACAAAGGCGATGCTAT
TTTACCTTCGCCTGGTTTGACCAAAGATGTTGTTGAGAAGTTTATGGAAAATTCGGAACT
TCTAGTTGAAAAGGCCTTGCGTAATCAAAGTCCTTTCACTTCCAGTAACGAATGACTTGC
TGTAACTAATTGGTTTATATTTAAATATTTCACTTTTTAAAGGGCGTTTGCATGCGACCA
TCGTCGATGATTCATATTGTTCGGATGCGGAAGATGGCTTCCATGAGTTTTGCACGCCGT
CTCATGTGATTGTTGGAGTCATAGCTCGCATATCTTCCTATTGTCAGATGTAATATCGAC
GGAAATGGCATCTTGGAGTATGGAAGCACTATTCTGCTTTGCTCCAATATTTAGGATGCC
GCATTTTTCATATTTTTTTTTACATTTTTCGCTTACGTATATAAATTGCTAGCAAGTATT
CGCTCTCTCTGTCTTGGTTATCTAATTGCTAACCGTCGCAATTGAAAAGAAAAAAAAAAT
ACAGAATAGACGATAGCGGATTGAACGATAGCATACTATTGAGTGCGTTTTCCCTTCTCA
TTTGAAAATTACTATCCGTTTTTCACTGCCGAAAGACTTG
Chr coordinates Chr XI from 237536-238891
w3c xhtml validator w3c css validator