Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RAD27
Systematic Name YKL113C
Alias ERC11, FEN1, RTH1
Strain S288c
Description 5' to 3' exonuclease, 5' flap endonuclease, required for Okazaki fragment processing and maturation as well as for long-patch base-excision repair; member of the S. pombe RAD2/FEN1 family
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RAD27 YKL113C
AGTACCCGGAGGGTTGGTATTATTATTTGCAGAAGGAGATGAGGTTTCTGAGGATGCAGC
ATTGCCAGCATAGCTTAGCAAGACTTTAAATGGACAGTTTTTCAAATGACAGGCAAATGT
AAAATGTTTGTTCCTATGCGAATTCTTTAAAATAATAGGGCAACGCGTCTGAAATTCGTA
CTCATTAATTACATCATACCAAGCACCCAAGGTGGGAAATTTTTTGCCTCCATGGGCTCC
AATGGCCAGGTCTTTATTAATTATAGGGTGCTTGTATTCATAATAATTCACGACTAATTT
GTCCATCCTTGTGAAATTGCAAATATGGTGATTTGAAACGTTTCCTAGTGCAGCAGGATC
ACAGATAACGTGTAAAGGGCTTAGCAGTTGATAATCCTCTCTAGTTGAGATCTAAACAAA
ATGCTGTCACTAACCGTAGTATTAAATGACACACTTTGGTGACTTTCGTTAATGGGGATG
TGGTAGTGGCCATTGCCAATAAACAAAAAGAACAGGGAAAGAAGTAGAAAGTGATATAAG
TTTGCTTGCCACTTTTCGTTTTTCACGAAAAAAACAGGCGAAAAAAAATGCTAGACTAGT
ACCCGGCTGAATCACACCTCGTTAACAGTGACTTTCGGTGACAGATACCCGATTGGGCAC
CCGGCTGGTAAGTTATGATAGAAAGCCAACGCTGTACTATTGGCTTAGCTATGGCAATAT
TTTGATTATCAACTAGTTTTATTAACGTTATAATTAGTGTAACCAGTTTTTCATCTATTT
CATTTATTTCATTTATTTACTTTAATTGCAGATCCCCCTAACGCGTTTAAAGCTTTTATT
CACTAGCTTATGTATTTTTTATAGGAAACGCGACGCGTAACATCGCGCAAATGAAGGTTT
TGATGTATTATAATGAGGTATTCTTCCTTATATACATCGATGAAAAGCGTTGACAGCATA
CATTGGAAAGAAATAGGAAACGGACACCGGAAGAAAAAAT
Chr coordinates Chr XI from 225875-224727
w3c xhtml validator w3c css validator