Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VPH2
Systematic Name YKL119C
Alias CLS10, VMA12
Strain S288c
Description Integral membrane protein required for vacuolar H+-ATPase (V-ATPase) function, although not an actual component of the V-ATPase complex; functions in the assembly of the V-ATPase; localized to the endoplasmic reticulum (ER)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VPH2 YKL119C
TTTTTTCCATGCTAATTCTTGCCGCTCCTCTCCGCCCCTTCAAAAACACTCGGAAGGCGG
GTAGCATTAAAAGTCGAACAGTTTGTTGGTAACTTTTGTAGGTATATGTGTACCAATAAC
CACAAATTAAGTATTGATTATCACAGTCAACCTCTTTGTATATCAAAAATTATACTCTGT
ATTCATAAAAGGCAGTTATTTTAAAAGCAAGTAACGGCAGGAAAAAAATTATTAATAAGT
ATAAAAAGATTGGACGAGTCCGGAATCGAACCGGAGACCTCTCCCATGCTAAGGGAGCGC
GCTACCGACTACGCCACACGCCCTATTTACTGTTAGTGTATTTCCACTTAGATTACTATA
ACAAGCTCTTTTAAACAATAAAACAGTTCTATAACAACCGATTTACGAAATTCTTCTGAG
TAAATGAGGTCACAAATGAACTTTCTTTAACTTCCTCTTTGTCTCCATTCGTTTTTCCAT
GCTTTTTTTGTTTCTGTCGAAATGAAATCCTTGTATCATCTATTGGCTAGTATTCGTCTT
CCTAGAATATTATCACAGCGGTGTAAGATGATGACATAGAGATTGGGAAACAGTTATCGG
TCTTAATGGAAGCTGAAATGCAAGGATTGATAACGTGATAGGGTAATGAATGGCAAAGTA
TAGAAGAAAAGAAGTTAGAGTAATATTATCATGTAGAAAGACCGATTCCATTTTGAGGTT
TCCTATACCCTCGAGGGGAACTTTTAGGATATTCTGTGTATCTCATACTATAGTCTTTAA
CTATGATTGAATCCGAACAATTATATTGTTCACGAAATACTCAGTTTTACAAAAATCTTG
TGTATTTAACTGACTCAAAGTAGACATGACGGACGTGTGAATATTTAAAATGAGAAACGA
GGAAGCGAAAATAAAGCAAATCTCACATGAAAACGCTGAAAGAAATGAAGAAAAGGTAAG
ATAGGATAATTGACGATTGGCATCACATAAAAGAACTCTA
Chr coordinates Chr XI from 219217-218570
w3c xhtml validator w3c css validator