Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name OAC1
Systematic Name YKL120W
Strain S288c
Description Mitochondrial inner membrane transporter, transports oxaloacetate, sulfate, thiosulfate, and isopropylmalate; member of the mitochondrial carrier family
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OAC1 YKL120W
ACAACCCCACCATCTAACACGCACAATAGTAGGCCAAGCCACGATTTTTGTGAGCTGCAT
CCTAATAATAGCCCGGTGATTTCCGGCATGCCATCAAGAGCTAGTGCTATTTTCAAGAAT
TCGATCTTTAATAAATCCAATGGAAGTTTTATATCCCTAAAGTCAAGAAGTGAAAGTACG
AGCTCCACGGTGTTTGGACCGCATGATATTCCGAGAGTTTCTACCACTTATCCGAAGTTG
AAATGTGACGTCTGCAATGGATCTAATTTTGAATGTGCTTCCAAAAACCCCATTGCTGGC
GGTGATAGCGGTTTCACGTGTGCTGATTGTGGTACAATCCTCAATAATTTCAGATAGAGA
ATCAGAAAGTAAGAGGAAAAACTATCTGTTCCACCGTCTTTAGATCATAAGCATGTCTGC
AAATAACATAGTATTATTATTTATATCTGTAGCGATCTTTATTATTTTTCATTACTGACA
CATTTTCTCACAGAACCATCTACAACCCGAAAGATGCCGGAAACGGTCTTAGGCCGATGG
GGTCTATTAGGGCCTACAGAGACGTCAATTGGGCTATAAGAAAAATGAAATCGAGGAAAG
ATTTTCCACTCTCAAATTAAGTAGGGCAAAAATATGCTTTTGTTCGCATGTGGTGTTATT
CCAGTTGCGAGTCAGGGTCTGCCGATATGCTAAAGGAGGTCACGAAAACGAATCTGGCAT
TTAATACCTCATTAAGTTACAGCGGAATCGGCCTTCTGTTGCGGAAAAAAAAAAAAAAAA
GAAAACGAACATTAAGCACCGCTGAAATTTCAAGCTGTGACTAAGTCGTCAAATGATAAA
TACTGCATATATATAAACTATGTGATTATATGCAACATTAAGATATACTTTCTTCTTCCA
TAATGCCCCCACTCCAGAACTCCATCCGAAATAGTTTTCCTTAGATTGCTATAGCAAGTC
AGACACAAGCACATCTCATCGAATTATATCGTAAGCAAAT
Chr coordinates Chr XI from 217344-218318
w3c xhtml validator w3c css validator