Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPC25
Systematic Name YKL144C
Alias C25, YKL1
Strain S288c
Description RNA polymerase III subunit C25; required for transcription initiation; forms a heterodimer with Rpc17p; paralog of Rpb7p
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPC25 YKL144C
TCATCAAACTCATCCTCGAATTCGTCTTCATCTTTTGCTTCACCGCTCCCTAGTAATTGT
GCGAAAATGTCATCTTCCTTTTCTTCTTCTCCATAGTTATCGCCTTGAAGTTGTGTCTTT
TTGCTGATGTCTTCAACCACAACATCATCATTAACAACATATGCTTCATCTTCTAAAGCT
TCAAGCACCTCTCTTAATGCAGGATTCATATCAGGTTTGAAACCTCTAATTTCATCGGTG
GTATCTTGTTGGTGTAGTAAATATTCTGGCTTTGCCATCCCTCTTTGAAACACAGGTAGC
GCGTCATCCTTCTCAATTTCATCACGTCTATACTTAGGTTCGATGAATAAATCTTCAATG
TTTTTTTTTTCGACCTTCTGTTCATTGCCTTTGGATGCTATAAAGATGGAGTTTTCAGGG
TCGAGACCTATTGGCTTCAAATGTTGAGTATAATCGTATTCAGAATCATCAAAATTAATA
CCATATAAAGCTGCTTCTCCCACATGAGCCCTCCTACCCTTTGGTTTTGTTGAACTCACG
TCTTTTTTTCGAAGATCTGCTTCTGGAGAAGTTTTATTTGGATTGGAGACAGGAACCAAA
ACGTGCGCAGAGGCATCTGTATCATAAAATGAAGGATCATCATGGGGTCTGTGTACCACC
ACGTACCTTTGGGAGTTTTTAGAGCTAAATTTCTTCGACATCTTCGTGCTTTTTATATTC
CCCTTAAAGTCTTTGAAATACTATACTGGTTGCTCGTAGGATTCGGTAAGAACCCTGATT
TAGATGCTCATAATATTCAGGCGATGCTCATCGCTTAAAATTTTTATTTGACAAATTTTC
AGTCGCGTTATACGGATTAGTTAATTTCGTATCATAATAACGAATATTCAAGCCATGTGC
AGAAATAGACGCAAGAAGCGTTATTCGGAAGAAACTATCGGGTAGTATAAAGACATTCTG
TAGTACTATTTAAATTAGAAAATTCATTGAACAAGGTAAT
Chr coordinates Chr XI from 176481-175843
w3c xhtml validator w3c css validator