Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NNR2
Systematic Name YKL151C
Strain S288c
Description Putative protein of unknown function; YKL151C promoter contains STREs (stress response elements) and expression is induced by heat shock or methyl methanesulfonate; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NNR2 YKL151C
TTTACCACCTTCATAATGCTTGACGACCAGCTGGAAGTGACCCTTCTGGGAAAGATCACT
CACAGGAGTGTATGGTCTCACCACATTGGATCCCTTTGGTGTGACAAATTTAGCAAACAG
AGCAGATGCTAGGACCAACCCCATTTCTGAGTCTTCGGTAGGCAGCTTAAAAGTAAACCT
TCTGGTGTCGTGGGATTCCTCCTCTATTTTAGATATTGGCAAGTCGATCCATTTGTCATC
ACCTTTGAACACTTTATTAGATTCATTGAAGACAAAGGAATGTTGGTTACGGTTTGCAAA
ATAGAATGCGGTAGCAGCTGCTATAGCAACTGTACCTAGAGCAATCGGTAATGCTTTTGA
GTGAGATCTGGATAATCTGGAAAACATGTTTTTGACTTGGAATATTATTTTAACCTATAT
ACGTTATACTATTGTTAGTTTGGCTGCTTCAAAACGTTAGTATTGAGGGAAAAGGTAAGA
GTACTTAACACAAGCGGGCATTGCGAGCAAACTGCATTCTTATATACGTACCTCTCTCGA
CAAGACACCAATCAAGGGCCCTTATTTCTCTTCTTTTTTCAAACGGAGAAACACTCCGAG
CGATAGTTCCTACGCTTGTTTGGTCTTAGACCTTTGAAGTTTGAATTGTCAGGGGTAACA
AGTTCCTTATACGATATAGGCGTCATAATGAGGGGGATAGTTTAGCATTGCGTGGAGGGA
TACTGAAGGTCATCGCAAATGAACCTAATTCATTCACCTATTGTTACCAGCTTGCATACT
AGAAATGGACTCTTATGATCGTCAAAAGGAGCACACACCCACACACGACTCCTTTGCGCT
GTAAAGGGCAGAATAGGGAGTGATGTGATGTGATGCGATGTGATGGGTCTTGCAACGTGA
TCTAGTAGATATATATGTAAAGGTGTAAATAGGTATATAGGCGTCGGTGAAATTTTATTA
GCAACACCAGTTCAATACGATCACTACCGTATCACTGGAA
Chr coordinates Chr XI from 165930-164917
w3c xhtml validator w3c css validator