Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RCN1
Systematic Name YKL159C
Strain S288c
Description Protein involved in calcineurin regulation during calcium signaling; has similarity to H. sapiens DSCR1 which is found in the Down Syndrome candidate region
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RCN1 YKL159C
AGATAAGAATATGAGGGTAACAATGAATGAGAACTCACTTTGTAATCACCAGTTGAAGAA
TGGTAAACAAGGCTAGTAATACATCCTGGTATTTCGGTCTCATGTTCAAAATAATCAGTG
GTAATTTATATTATGTATATCTTTTCCTTGTTTCTTTGTTAAGCTTTTGTGTAAACATAC
TTTAGTAATTGTGACGTTTTTTGGCACTTCGCACAGGCGTGACTAGTTTCTGTGAACAGA
GGGCGTCTATTCATGATCTTCACAAATCTTGGGGGAGTTAATTTACTCTGCTTCCACATT
ACATTGATGCGCAGTGATCTACTGACGCCTGCTGGTGGTGAGTACACATTAGATAAATAC
CTAGGGTGTGCAGCAATAGACCTTAAACAAGGGTGAGCTTTGCCTATTAGAGAAGAACCT
CTAACTGCGCTTTTCAATAATAGCCACCGAACAATTGGCATATTATGCAACCTGTGTTTT
TAAGTACCTTTTTATGTCAGATTTTTTGAACTATCCTTCGATTGTTATTTCTTGATATAA
CGTTTACATGATTTCTTAATTTACAACGCGGACGAATTAGATTGAAATTATTTAGCATAT
CTGTCTAAGAGCACATTAGATCGAAGTACCGTAGCACATCTGCCATACTATCAAATGCAT
CATCACGAAAAGGCGCAGTGTTGATGGATAGTAAATATGAAAAGGATCTCTTCTTAGGTG
TTCCAAGCCTCGCTTCACGTGTAACATACACAGTTTAGAAGTTTACCAAACCGCGGCAAG
GCGCTGTAAGGTTCAAGAGGCTTTGAATTATGCTATCTTACTATCTTGCCGCAAGTTGCT
GTCAGGTGTAGTTCCTAGGCGGCTCGTTGACAAGACCCTTCTGCCCAATGACTTCTATAT
AAAGTATGGTTTTCTTTTTAAATACAGTAATTCCATGAAAAAAAGAGGGCCAAAAAGATC
AAGCAATAAACCAACCGATATATAAAACACAGAACTGCAG
Chr coordinates Chr XI from 154451-153816
w3c xhtml validator w3c css validator