Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PIR3
Systematic Name YKL163W
Alias CCW8
Strain S288c
Description O-glycosylated covalently-bound cell wall protein required for cell wall stability; expression is cell cycle regulated, peaking in M/G1 and also subject to regulation by the cell integrity pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PIR3 YKL163W
TCTGGCTTCGAGGAATTATTACCTAAATAGGAAAGGCAGAATATATTAGAAAAAAAAGAA
AAACCAAATGAGAAAAGTGCTGGTGCTAAATAAAACATTATTGAGGGGCCAAGAGGGGAC
AAAAGAAGATATAACTAGATCATTAAGTTTTCGCTCTAGTAACAGGAACAAAGATTGTGA
GATACACTGTTATGCTAAGAGACGGTGCGATATTCTGTACGAAAATTATTTAACTATTAA
CTAAATGTATACCACTTCACGTGCCACCGAGTAGGTTTCTAAAATGTGCAACCATTTTAG
GTATGTGCGCAGCTCTTTATTCTAAACGGGAGTCACTACATTACTATTATCGTGTTTTTG
CCCATGTACTTTCTTATAATCTTAAGACAACAACGGGATGATAGGCGCATTCGGACTTTC
ATTGATGCAAATGTGTGAAAAATGCATCCAAAAGACAACTTTTGTACAGAATACAATTGC
AAAAATACTTTACGGGCATAGATCGGTAAGGTCACCGGGAAGCTAGCGTAAGAGACCTTA
TTCGGAACCGAGCAACCATTTCCGAATGTAGTAGTAGTTGAAGGAGTAAATCGACCTTAT
TGTACACTACTTCCTTTAAATTTGATTTCTGGCCCCGCGCAATTTCTTGGCGGTTAAGCT
GTATTTTTACCTCATCGGGAAAAGTTATTGCAAGTTAAAGGGGATCAAACGATTAGCAAA
CTAATTATAGATCAAAGGCCGAGGGCTTTCTAAATTTGGCATATTTCGCCGTCGACTGAA
ATAGAAGGGATAAATCATGCATCTCCAGGATTATCCCTACTCCATTCATTACAACATGCG
CCAAATCAAGCCTATATAAGATTCTCGTCATTTAGCATGCTCTATTGATTTGTGTCTTGT
TTTGTCTAACACTGAAACTGTAACCTAAGATTTCTTTAGATAATTATTACATTTACATCA
ATAAGAAATCTCATAAAACAAGTACTGTTTATAAGTAAAA
Chr coordinates Chr XI from 144401-145378
w3c xhtml validator w3c css validator