Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MCD4
Systematic Name YKL165C
Alias FSR2, SSU21, ZRG16
Strain S288c
Description Protein involved in glycosylphosphatidylinositol (GPI) anchor synthesis; multimembrane-spanning protein that localizes to the endoplasmic reticulum; highly conserved among eukaryotes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MCD4 YKL165C
CATTTTTTTCTTCTTAATTCGTCTCTTCATTTCATAAAGCTTTCTTTTGAAACCTATGAA
ATGAGCTTTACAGTTCTTCACTCTTTTTTTTAAAGTTTGTTTATTTTTTTATACTATATA
CATTATTATTTCTAAAAAATCATTATAAATTACGTTAAAAGCGCACCTTATACTTTGATA
GAGTTTTCCCAGAAAAAAAACCAACGAATTTGATAGTACCAAGACTTCACGGGATTGAAA
TCGGATGCAACTTCAACTATTCCTGGGACAGAATATTTCTCAGACATTACTTTGTGTACC
GTGGAGCCCTTTCTCATTTGAGAAGGAAACAAATTGTTGTCATCTTATAATGCCATATAT
TCGTCACTATCTCAGTCAAAATTTAAGAAAATTGACATGCATATTATCATCCATTTAGTA
GTATACGTGTTACTAGTATATTATCACACACGGTGTATTCTGTACACATAATATTATAGC
CTTTAACAGCAATGAAATCCAACATTCCCCACAACATTCACCAATTATCCATGTAAATGA
AAAGAGTTCTTTAATATTTACATGAGTAATTCCATTACGTTTCAATTTTCTATCCTTTGT
AATCCGATATAGTGTAACGGCTATCACATCACGCTTTCACCGTGGAGACCGGGGTTCGAC
TCCCCGTATCGGAGTTTTCATTATTATTTTTAATCTAGCAGTACTAGCGTGATGTTAATG
TTACTCATTTTATTTTGTTGAATCATTATGGTGCAGTACTTTTCATAGATATGTATTTCA
TATGTGTCTTTTCGTCCTAAACTACAGGATGTTAATCGTTGAATATGTATATGTTGATGC
CACGTAAATAATATGTGTATTCTTTTTGCATCGCTGTCATTAAACGCGAAAAAAAAACCT
TAAAGGTAAAAAGAACCGTTCTTTACTATATATTCAACAACCCATCTTCGACCAAAGCAT
TGAAGAGCCTTAGGACTCATACAACTGAAATCTGTAAAAA
Chr coordinates Chr XI from 140691-137932
w3c xhtml validator w3c css validator