Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PRS1
Systematic Name YKL181W
Alias PRP1
Strain S288c
Description 5-phospho-ribosyl-1(alpha)-pyrophosphate synthetase, synthesizes PRPP, which is required for nucleotide, histidine, and tryptophan biosynthesis; one of five related enzymes, which are active as heteromultimeric complexes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRS1 YKL181W
CGGCTGGTTGGTTGAAATCGTCAACTACAACGTTGAAAACCAACAATATGTTGCAGCTGG
TGATCTAAGAGCTTTAGACACCGTTACCAATGTTCTAAACTTCATCAAATTACAAAAAAT
TGATATTATTGAACTACAAAAGTCCTTATCTTTGGAAGAAGTTGAAGGTCATTTGTTTGA
GATCATTGACGAAGCTTCCAAGAAATCTGCTGTCAAGCCTCGCCCACTTAAATTGGAGAG
AGGTTTTGCTTGTATCCCATTAGTTGGTATTTCTGTTCCTTTCCATTCCACCTACTTGAT
GAATGGTGTTAAACCATTCAAGAGTTTCTTGAAGAAGAATATCATAAAAGAAAATGTGAA
GGTTGCTAGATTGGCCGGAAAGTACATTCCAAACTTGACTGCAAAACCATTCCAGGTTAC
TAAGGAATATTTCCAGGACGTTTATGATTTGACTGGCTCCGAACCTATCAAGGAAATCAT
CGACAACTGGGAAAAGTATGAACAATCCTAATTTCTTAAGTGATTATATAACCGTAAGAA
ATATTTAACTTTGAAACTCCTGTATACTAATGTTTAATATAGCTGGCTTATGATTTTAGT
TCTCTTCTCCTATTATAAATAGATACATTGATTAGGTATTTTTATAATATACTTGGGATT
AACAGATGCTATATGAATTTTTTTTTCCGCCGCAAGCCCTCGCTAGGGCGGGGCAGATGC
TGAAGAAAAAATTTTCTGTTCCATTGGGTTATGTTTAAAAATCAACGATATTCGAACATA
ATCGATGACCTTGATGATTAGCGAAGTTCTGCTCTAAAGAAATTAGCTTTAAAAACAGCT
CCATTATTAGTGTAAACTGCTACTTCAACTCTTTACTCGAAAAGTTGAAACAAGTGTCTA
TTCCGCACATCTCTGCAATAACCGAACCTTCACGATTTAGCTACAATCCCACATCTGCAG
ATTCTACCGTTTAATAGTCTTAATTTGAAGAGAAATAAAA
Chr coordinates Chr XI from 107316-108599
w3c xhtml validator w3c css validator