Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DPH2
Systematic Name YKL191W
Strain S288c
Description Protein required, along with Dph1p, Kti11p, Jjj3p, and Dph5p, for synthesis of diphthamide, which is a modified histidine residue of translation elongation factor 2 (Eft1p or Eft2p); may act in a complex with Dph1p and Kti11p
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>DPH2 YKL191W
ATGGAAGTTGCACCGGCCTTATCGACTACTCAGTCGGACGTGGCGTTTCAGAAGGTGGAG
ACACATGAAATTGACAGGTCTTCATACTTGGGGCCATGTTATAATAGCGATGAGCTTATG
CAACTTATCTCGGCTTATTACAATGTCGAGCCTCTCGTGGGTTATCTGGAACAGCACCCG
GAGTACCAAAACGTGACCTTGCAGTTTCCTGACGATTTAATCAAGGACTCCTCGTTGATA
GTAAGGCTGCTGCAATCGAAATTTCCCCATGGGAAGATAAAGTTTTGGGTTTTAGCTGAC
ACAGCGTACAGTGCATGCTGTGTAGACGAGGTCGCTGCTGAACACGTACATGCAGAAGTC
GTGGTACATTTTGGTGACGCATGTTTGAACGCCATCCAAAACTTGCCCGTGGTTTACTCA
TTCGGAACTCCATTTTTGGATTTGGCACTGGTGGTGGAGAACTTTCAGAGGGCATTCCCA
GACTTATCCTCCAAAATTTGTTTGATGGCAAACGCACCCTTCTCTAAGCATTTGTCACAG
CTGTACAATATTTTGAAGGGCGACCTGCACTACACAAATATCATATATTCCCAAGTGAAC
ACCTCTGCGGTAGAAGAAAAATTCGTAACCATACTTGACACCTTTCACGTTCCCGAAGAC
GTAGACCAGGTGGGTGTGTTCGAAAAAAATAGCGTGCTGTTTGGTCAGCACGACAAAGCA
GACAACATCTCGCCCGAGGACTATCATCTTTTCCATTTGACCACCCCACAGGATCCGAGA
TTACTGTATTTGTCTACTGTGTTTCAATCTGTTCATATTTTCGATCCGGCTTTACCTGGC
ATGGTAACGGGGCCATTTCCCTCTCTAATGAGGCGTTACAAGTACATGCATGTGGCAAGA
ACAGCGGGATGTATAGGTATTCTGGTCAACACGCTGTCGCTACGTAATACAAGAGAAACT
ATCAACGAGCTGGTCAAGCTTATCAAAACTCGTGAGAAAAAACACTATTTATTTGTTGTC
GGAAAGCCAAATGTGGCCAAGCTAGCAAACTTTGAAGATATTGATATTTGGTGCATTCTC
GGTTGTAGCCAAAGCGGTATCATCGTTGATCAATTCAACGAGTTTTACAAGCCCATTATT
ACACCTTATGAATTAAACTTGGCCTTGAGCGAAGAGGTCACATGGACCGGGAAATGGGTT
GTGGACTTCAGAGACGCCATTGATGAAATCGAGCAGAATTTGGGCGGACAAGATACCATC
TCTGCCAGCACAACTTCCGATGAACCGGAGTTTGATGTAGTTAGGGGAAGATATACTAGC
ACATCAAGACCACTGCGAGCGCTAACGCACCTGGAGTTAGAGGCGGCCGACGACGACGAT
TCCAAACAACTGACTACAAGACATACCGCCTCAGGTGCCGTCATTAAAGGTACTGTATCC
ACTTCAGCATCAGCACTGCAGAATCGTTCGTGGAAAGGTCTAGGAAGCGATTTCGACTCT
ACTGAGGTTGATAATACTGGAGCGGATATCGAAGAAGGTATTTCCGGTGTCGCACGTGGT
TATGGATTTGATCGCGAAGACGCTATGAAAAAGGAAAACAAATGA
Promoter Sequence
Download FASTA
>DPH2 YKL191W
TAGTATTAACAGGGCTGGTTATATAGATATATATATATACGGGTCAATCGATCTATTTAT
ATACATACGAATATAATATGACATGGGGGTGACACGATACAATATAATAGAGCGGGGACG
GACACTTAGTTTGCGTCGGGATTGGAAGCGATATAATCGACCGTTTCACCAACACTTCTC
AACTCATCAGCCACTTTGTCAGGGATTTCAATATCAAATTCTTCTTCAATAGCTACGAGC
AGCTCGACAGTGTCCAAGGAGTCCAACCCCAAATCCTTGTGAAATTGGGTATCGCTGGAG
ATTTGCTTGTTGGCAATGTTGGGAGAGTTCTTATCAAACGCCTTGATAACATCAATGACC
CTTTGAGAAACCTGATCTTTGCTCAAGTTTGCAGAATAAAATCTTTGTGCGAGTATGGTG
TTGGACATAACGGAACGGCCCATTATAGTGCGGTACGCAGAAGGTGCCACGCGGGAAGAA
ATGCGGCAAACGGATCTAAACATGGCAAGGAAGGTGCTGTATTGAGTTAGTTGTGTTGTT
TGTACTAATTACACTGCAAGTGTGACTATTCTTCCTTTTGCTTCGTCATCACCACCTTTC
TCTTTTACTCAGAACCCGTTCGAAGGGGCGAAGAAAGAAGCAATTGACAAATAATCTGTA
TTCCGTCAACAGTGATATATGTCACGTGACTCTGATAAAACTCCATGGAGTCTCTTCGGA
GTGTATGTGTGAAAAGAATAATACATATAAGACATCTACAGGATCAGTCTGATAGTTTTA
ATGCTATGGTAGACTTCAGAATGTCTTTTTAAGTATGCCATTTGGTTAAATCTGTCCTTT
TATATGTACTTGGTGCTTCTTTTTTCTTTACTTTTTTTTTTTTCAGTGAGAAGCTCATCG
CAACAAGAAGAAAAAAGACTAGTTCAAAGGTAAAAGAGTTAAGATGATTAGTGATGGATT
TCTAAGTGGCAGCGTTGAAAGATCGTGCAAAGGTTGAAAA
Chr coordinates Chr XI from 81035-82639
w3c xhtml validator w3c css validator