Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PEX1
Systematic Name YKL197C
Alias PAS1
Strain S288c
Description AAA-peroxin that heterodimerizes with AAA-peroxin Pex6p and participates in the recycling of peroxisomal signal receptor Pex5p from the peroxisomal membrane to the cystosol; induced by oleic acid and upregulated during anaerobiosis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PEX1 YKL197C
ATGACAGCAGCAAGGGAAACAAAAATCTTTTAAATCAAATTAATTGTTTAAATAATATAC
TATGTAAGCATCGATTCTCCTAACTATTATAACCAAAGGTTGATTTGAAGCCATTGGCAT
TGTATTAGAATTGATTTGTTTCTTCAGTGTAAAAAAGTTAAAAATAAGCGACCCCAGTGA
GGGTTGAACTCACGATCTTGCGATTAACAGTCGCACGCCTTAACCAACTTGGCCATGGAG
TCTAATTGCTATATTTTTCTTTTGAAAACAAGATATATAAATAATGCTTGAGCTGGAGCA
TTTACGTTGTAAATGTATAATTAGTGTAAGAAACCGCTGGGCCCTATTTGTTGATGAAGT
ATTTACTTAAATGTAACAGAATATACTGGAAGTCCCCCCTCGGGCACATGGAAATTCACT
AAAAGGAATTGGTAATGCATATGATATTACTACCGTTTCTCATTTCACTTTATATGCTTT
CAGTGATTGTGTTACTACGTGACAGTTCTTACAATTCAGCGCCGTTACTCTCTATGAGTG
CTCTCATTATTTATATCATATTCTTACACTTCATACAATTATATATACTCGTACCATGGA
TATTAGAGGATAGTTGGTTTTTGTTTAAACTAATTCTATGTAACCTCGATGGCATGAGTC
CATAATACTGTACTGGCGTATGCCCTTGTTTGTGGTCTTTGTGCAACCATTTCAGGCTTT
CTTATTTGCACAGGGCAGTTGCGACCCTGATAAAAAAAAATGGCTGATCAATCGGCGTGG
ACAAAAAAAAACATCGATTTCTATATTCATGGTAATCTGTCGAATTCTCCAACCAAGTTA
GCTGGACTTTATTGTCTTATATCCGATTACTATCGCGATTTATTCTTGTGCGTAGCCGCA
ATTATAAAGGTCCGGAATATCTCTCCGACTATTGTCATCGTCGAATTTCTTCTGGAAGGG
ACGGCAGTAACAAGAAACACCTGAGGAACTGCTCTTTCAA
Chr coordinates Chr XI from 73865-70734
w3c xhtml validator w3c css validator