Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TRP3
Systematic Name YKL211C
Strain S288c
Description Bifunctional enzyme exhibiting both indole-3-glycerol-phosphate synthase and anthranilate synthase activities, forms multifunctional hetero-oligomeric anthranilate synthase:indole-3-glycerol phosphate synthase enzyme complex with Trp2p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TRP3 YKL211C
TATATGTTCTTTGCTTTGCTACTAATCTTACTTTTTGTTTGCTTATATCCAGCGATTGGC
GGTTGCTCATCCTACTTAAAGGCCCTTTTTGATCATTTTCTTTTACCTTTATTTGCCACC
CGCACCTTTTGTCACACTACACGAGAATATGCCGCATGGAAGCGTAATGGCAATTCAAGA
AAGAGCTCTAATATTATTTACAATCACATGAATACAAGATCATAGCTTAACAAGGAGTGG
ATAGTCAGTAAAGGCGCCCTAAGCTCTACTAAAAACTGGGCTTTAAAAGATGTTCCTCGT
CACTTGAGAATCTGTTGTCCCTATCTGGTTCCTCATCATACAATCCACTCCATCGTTTCT
CCCACCCTACTACAAACTAGTGAGGCGAACGAGAAAATAAGAAACACTAAGGCTCGCTTT
TCCTGCTGGACAGAGACATGCATTAGTGTTTGTTGTTCTCGCGCCAGTCGCTGTTTTTGC
TTGCAAGTGCGACGTCCTCTTCTTCTTCTTCTTCTTTCTTCTTTGAGATGCGTAACAACA
CAACTACATTTTGTATTTTCCTCCCTTTTATACTCCTCCGCTGGAGTATTTTTTCGTATT
TTTCACTTTTTTTGCTTCTTATAGGCCTTTTTGAACTATTTTCTGTTAGGGCTTAAAGAA
AGCGCAGCAAATGGCTGATTTTAAATGCTGTTTTCTCGAAAGCAATGCTGATGATGTACC
ACAAAGTAGTATTTGCGCTTAGCTTGTCGATATAAGTATGCCTTTGAGCCAGTATTAAAC
TTCCTACTATCTCTTCTGGACCTCACCGTGCTATTCATATCACTGACGACGGAAAATGCC
TCTTGTAGTAATCATTGAATGATCATCAATGGCTCGTTGACTCATTCTAATCTATAGCAG
ATATTAAGGTACGCAAAAAGTTCGACAAGGAGCTGGTCAGTATTAACACATTACCAAATC
TGTTTGGTTCTACATAGAACGCCATAAAAGTAAGAAAAAA
Chr coordinates Chr XI from 38153-36699
w3c xhtml validator w3c css validator