Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name URA1
Systematic Name YKL216W
Strain S288c
Description Dihydroorotate dehydrogenase; catalyzes the fourth enzymatic step in the de novo biosynthesis of pyrimidines, converting dihydroorotic acid into orotic acid
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>URA1 YKL216W
GTTGTATTAATTTTCTCGAAGGGATTAGAATGTAAGTACATTTAAATAGCGCCGCAAGAA
ACATAACAGCCGTTAACACTAGCAAGATGGTAGATTACTGTGTCTAAGAATTTAAATTGT
TTTGCTTGCTTTTGCCACTATAAGACAATAATAGTAATAGAAAAGAAATGTTAGTCGAAC
AGCAAATTGGTAAAAGTGGAAAAAATTATTTCGTTATTCATTTTAGGCCGTTCAGAAATA
TAGCATTTTGGTTCTTGCACTGAATGGGCCCTGAGGACAGTGTGCGGCTGGATAGCCATA
TACTTCGACATTACTTTTCACCTTTGAAGGGGGATGTATGCTTATACACAATCAAAGCTC
GGCCTGTGCAGGTTTCACTACATAAGCTTTTTTACCATAGAAATCTTGCAGAAGGAAGTA
AGTATCAAGATATTACGTATCGCATCCATAGAACGATAGCAGAAAAATGCAGTATATGAT
AACGATATGCTTCACAGCTGCGGCCCATTTGGGGAAAAAAGGAAAAGGAGCATCCTCGAT
CTTACAGATGTCGCTTTTTCCTCTTGAGGTCATTCCCTAACCTTGGATCCAAGTCAATCT
GGTATCTTCCCACCCTAAATAGTGTATTCCCCATGTAATAAGATCGGACGATAAACTTCG
AAACAATTCTAGCCTTTTTTATTAGATATTTACTCTACTTTAGATTTGGTGATTTTACTA
AATGTTATCCTTCAGCCACTACAGCCTACTTTTTCTCACTAATATGTTCTTGAAGCCATT
TTCTTCACCGGGCTTTGCCGAAGGTTATTTCACGATCTTCGGCATTCGCCGAAAATTTTT
CAAGATGCCCATCACCAAAAAATAAAAAAAGCTTTATATATGGCATGGCATACGCATCGG
GAACCGGTATTCTTCTCTTGGATTACACAGTTTGGACTACTAGACGTTTCAAATAGATAT
ACACAATTACTCAAAAAAAAATTGAACTTCCGTACCAAAC
Chr coordinates Chr XI from 25215-26159
w3c xhtml validator w3c css validator