Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SRY1
Systematic Name YKL218C
Strain S288c
Description 3-hydroxyaspartate dehydratase, deaminates L-threo-3-hydroxyaspartate to form oxaloacetate and ammonia; required in the presence of hydroxyaspartate; highly similar to mouse serine racemase (Srr) but has no serine racemase activity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SRY1 YKL218C
AGGTGACCGTTTTTGCAGATATTGTAGTGAGATGCTCTACAAAAGGGGTTTCCTAATCTA
ATCTTTTACCATATCAAAAATGCCCTAATATTATTATTAAAGAGCTATCAAAGCCTGATT
CCTTAGGTATATGACTAGTTCCCGAATTAATGGCATTGATTCATTACTTATTTTATTAGG
GGGATGATAAAAATAATGATATCTTTTTCTGCAGCGTCATTTAAGTACTGATTGAGACTG
ACAGTTGTGATAGAGATATTAAGTAGTAGAAACGGTCCATGAATTGTTCTTTGTTAATAT
TCTTGCTGAGGGAGGCTTTTCTTTTGGGCTGCTATGCTTTCATTCTACTTAAGCAACGAG
ATAGGAAGCTTCAAAAGGTGAATGGTGAAATGCTGAAGAAGATTTCGTCATTCCAATCCT
CGAGAGTGCGACGTAAGTAGTGACTCTAATGAATTTTCTATGCCTCATAAAGCTTGAGGT
ATATTTATCCATACGCAAATAATACACGATCTAGGATTATTGTAGTATGTTATTGTTTGA
CAATATCCTTGGACAAGTTCTAATCACTTATATTTCCCAAACATGATTCGTGTATTTTGG
CGTTAGAAAACGACGGCAAGTAAGCTCCCAACATTTACTTGACGAGTTTTTTGTCACTAT
CATCACGCCCTAGAGCCAAGTTATATTTTTATCGTAAATTCTGTAAATTAACAGTCATTC
TAAGCAGGTTGTTTTAATATTTACAGGTAACTTGGCTGACTTCTTTTAAATGTGGCTTCT
ATGACAAAAAAACTGAAAAAAATGACTAATTAGTAAATTCAGCCTCTTATCATAAAATCA
GGGTCTATAGGACGGTACGTGAGAAAAAGATAAGCTTTGGAATATAAAGAGTTACATTTT
CATTCTGCAAAAATTCAAATAAAGGAGTATTGAAAAAAAACTTAAAAAGTACAAATAATT
AATATAGTTCGAGATATTTAGTTTTCATTGAGTTGGAAAA
Chr coordinates Chr XI from 18339-17359
w3c xhtml validator w3c css validator