Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VPS1
Systematic Name YKR001C
Alias GRD1, LAM1, SPO15, VPL1, VPT26
Strain S288c
Description Dynamin-like GTPase required for vacuolar sorting; promotes fission of retrograde transport carriers from endosome; also involved in actin cytoskeleton organization, endocytosis, late Golgi-retention of some proteins, regulation of peroxisome biogenesis
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VPS1 YKR001C
TGAGGTTGGTCTAGACGTGCACAGATTAAATCGATAGAAATACCACTGAACTTTATCTTG
ATAATCGGGACAAACGCATCAGGTACAGGTGCAATTTCATCCAGTTCCTTCCTCTCTCTC
AGTAGTGAATCAAATACCGTAAAAAAATCTTCCCGAGTTACATGTTTTGGAACAACTACC
AAAGTATCGATATCACTACCAGGCCCATGGACTCCTAGTCTATAGGACCCATACGTAAAA
ATCTTCCCACCAGCATCCCTTGCCATCCCGTCTGACATATTTTTCTTCTTCGATACTTCA
TAAACAAATCTTTGTGCCAATTCCTGCAATATTTTCAACACTTGTACCCTATTGGCAGTT
TCTTGCTCTGTTTCGAACGATCCTTCCTTTTTCAGTTCTTGGATTAAACTATCATTTAAT
TTATTTTCTGCTGCTGTGGCGCCCACGGTGGAAACAGGTCCAGTAATACCAAAAACCTTT
TGAGAGCTCATTATTTGTCTAAAAAAAGTTTATGCGTTAAATATTTTGCTAATTCTAGGC
CTCTTTTGATTCAAAAAAGACCGTTTAAAGACTTGCTCACAGTGAAATTATTTAGCTAGT
TTAGTGTCTTTAAACTTTTGCTAAAACGTTTCACTTGAAAAATCGTTCTAATATCGTCCA
GAGGATAGTATGATAGCTTCAGAGAATTCGATAGATACTTGAATCCTCTAATAGTCGAAA
AATGCTCGAGGGTAAACCACTTGTGCGCTTGGACTGGCCTAGTTTCCAAAACCAATGTTC
TAATGGATTGATTTCTTCCCCAAACATTATTAAGTGGCCGGGTCACCCAAAGACTTGGGC
GCCGTTGATTCGCGTCGCTTTGCCATCAAGAGAACAACATATCTTCCAAGACAGACCGAG
ATAATTCATCTATTTACTCCTAAAAAAGAATTAGAGAGGCCTTTTATAGCACCAAAATAA
GGACCGTACGAAAACTGCACATTTTATATTATCAGATATC
Chr coordinates Chr XI from 442722-440608
w3c xhtml validator w3c css validator