Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PRY2
Systematic Name YKR013W
Alias YFW12
Strain S288c
Description Protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRY2 YKR013W
TCAAAAATTCACGGCGGCAAAAGGTCTGTAACTACCTAAACATTAAAAGCCTTTGAGCTA
TAAATCATTATGTACACTGAGAATGCCACATGCTAAAACAAGGAAGTTTTCAGCGAAGTA
GCACATTAACTGACCACTCAATAGAAAGAAAACAGAAAGTGGAATGGATGGCCACTTTCA
TGTTATCAGTGGTGATTACTTGATGACAAAATAACGCTATTCGAGAGCGAGCTATAATTC
TTGACCAACTGGCTCGACCTTCTTCGTCATACTGTAGATCAAAATTCTACCATTACTGGA
TTCTTTTTTTTTTTTTTTTTTTTTTGGGCTAGCTATGAACGTTTCCTAGTCCCGCTCACG
CATTCTAGTTCTGCATTGGGTAAAAGAAAGCATATCATTAAGCGGCAGTTTCGGGTCGTT
CTAGCCTCGAGCAAAACGAAGCTCAGCTCGCCTCTTTCACTATCATCCTGTGCTCACGTC
CATGCGCATTCTTGGCAATTCTGCAGAGATCTCTCATCTGGGTCTTAGCGGTTCTCCGCA
CCCTGGCGATGTGCTTCGAGAACGTCTTTGTTCATCACATAGACTGCACTGCACTGCGCC
ATCATCTCGATCGATCGCGAGACTTTCGCGGCGACATTCGCGAAATGCCAAATGAAATCG
AGCCGGCCTCGTGAAAAGGTGTAAAAAAAGAAAACGCATCACTGAAATGGACCCCGTTAT
GAAACGAATGAGAGATCTGCCCATAGATCATCTTTCCTATAGCGGGAATAAACATGTGTG
CTATTTACAGTACATTTCGTGTATCTCACGCACTTCTCTATATGTAATGTTTTTGAAACA
TAGACGTCGTTCAAAGGCAATGCTTTTGATCTTTGTATATATATATGCTTGTCGCAGAGT
GTTACATATTGCTGTGATGGATCTGTTGGCTCTTGGTATCATCGTTCCTCGAAACAGCCC
ATCATAAAACAATACCATTCCTTTAATAAAACTTACAAAG
Chr coordinates Chr XI from 463959-464948
w3c xhtml validator w3c css validator