Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DAL80
Systematic Name YKR034W
Alias UGA43
Strain S288c
Description Negative regulator of genes in multiple nitrogen degradation pathways; expression is regulated by nitrogen levels and by Gln3p; member of the GATA-binding family, forms homodimers and heterodimers with Deh1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DAL80 YKR034W
TTTCTTAAAAGCGTGGCCAAACTCTTTCTTCCAGCCATTGAACTGCTGTTGGGTGTAAGC
TACAGAAGAAGAACGCCTTTGAGGGGCTCTTTCTTCCTCTCTTTTAGAATTCCGCTTAGA
ATGAACATTATTGTTACTGCTATGGAGATTGTTGTAGAGCCGGTGCATATTTTCCTCATC
AGAACCTCGACGAGGATCATGTTCATTAGAGTGCATAATATGGTCTAATGAGTGGTTCGG
TGACACATCACTCAGGTTTCTATCTACAAAGGATTTGGGCAATGCATGCTTCCTCTCCGC
CTCCTTGCCGTTGGGAGTTCTTCGTTTTTCTCTTTGTAAACTGCTAGTCAGATTGCCATT
CTCAGGTAATTGCCGCAATACTTCTTGGTTTTCTAACTCATCTGGTCTCGAATTTACTCT
ATCTACTTCTTCAGTCACCGATCTATCTGCCTGAGGTGGAGCGAAGTGAGTTCCAGACGC
TGTTGACACGTTAGACATCACCCTTGTTTATCTATCCTACCTTTTCTTCTTGCGTACGTG
CCTCTCAATGCGTCGTGTGAATTATCAGTGACCGGTCGTGCCTATAATGTCCTGCTAATT
TCCCACTAAATCTTTCCCCATGGCGTATTCATCGTTATGTTTGTGTCTTTTGTTCAACCC
AAAGGGCTGTAGCAATCTTCACCCGTTTGTCGTTGATAACGAGTTTCCACCTTATCACTT
ATCACTAGTGCTAATCAAACAGCAAAGAATGCTTGATAGAAACCGATCCTGGGCTTATCT
CGCTGCATTGTGGCGGCATCCCTGGACTGTAATCAGCAAGTGTTGCTTAGTATATATATA
CATCCAGCGTCAGCTTGAATTTGGATACAGTTACTGTTTTTTCGATTTTCTCTTGGTTAT
TCTTTCTGAGACAGTAGTAATTTTGTATTACTGAGCGGGATATTGTTTATCTGCCGTCAT
ACTATATTACATTATATTATATCATATTATATATAAGAGA
Chr coordinates Chr XI from 506898-507707
w3c xhtml validator w3c css validator