Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name UTH1
Systematic Name YKR042W
Strain S288c
Description Mitochondrial outer membrane and cell wall localized SUN family member involved in cell wall biogenesis and required for mitochondrial autophagy; involved in the oxidative stress response, life span during starvation, and cell death
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UTH1 YKR042W
TACAACCGAGAGCGAAAGAGACCGCTTGAAACGAAGTCATGAAAGCGAAAGCAGCAGTGA
AAGCGAGGTAGACGTTTTCGCCTTTGACCAGGCAAAAGGTATCAGCTCTAAGGTTGAAGC
CGAAGAACGCTACGCGCGGGCCGTTCGACAGTATTGGCGCATGACCAAAGACGAGCCGGC
TACCTTACCACTGCCAGGCACACCTACCCTAGCGGCTGTGAGTTTAGATATGATTGATGA
CAAAAGCGTAGAACAATTTTACACAATGAGCAGTGCCTTGATGGATGCAAACAGACTAGA
CTTGATTCGCCGCGATAGAATCCGGTGGCACCCGGACAAACATCGTTATCATAAGTCCAA
AGTCACAAAACTGTTTCAGGCCATTAACGGCCTGTGGGAGCAAGAAAAGACCGAGAAAAG
GTAATGAAAAAGTGGAACTAGACCCCACGTCAGCGGGCCTAGGCCCTTCAATGTGTTAGA
ATACACAGCGTGCCTAGTTCCTGGTGCCTGGATCTCGAGGCCGCGGCACTGGAAAAGCCC
TTTCTTTTCCAGATCGGGAAACCTAATGAGTCCATAAAAAGAAATGTAGAGGTGGTGTTG
ACGTTTTGCCGCTTTTGGGCAAGTAGGTCTTTCTGCACGGCCCGGCCCGGGTCGTGCGGA
AAAAGAAAAAAGCAGACAAAACAAAATTTTTCCTTTTTTTCGCCTTTGTTTCTCCTGATT
CGGGTATATAAGTGAATACCATCTAATGTGTTTCCTTCTCGAGACCTCGGCGTCTCCCAG
ATCAAAGCTCAGCAAAGATTTTAAACCGCAATTTACGCTCCTTTCATCGGTAACTAAGAA
GAAAAAAAAAAAAGTACGACCACACAATTTCCAGTGTATTCATTCCTTAAACTTCGTTTA
TTTTTTATTCATTCATTCATTTTTATTTGAATATAACCAACTACTAGTCCTTCCTTTAAA
CAAAAATTTACCCTCCCTTAATTTTTCAAGAAATTCCAGT
Chr coordinates Chr XI from 519527-520624
w3c xhtml validator w3c css validator