Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SHB17
Systematic Name YKR043C
Alias sedoheptulose-bisphosphatase
Strain S288c
Description Sedoheptulose bisphosphatase involved in riboneogenesis; dephosphorylates sedoheptulose 1,7-bisphosphate, which is converted via the nonoxidative pentose phosphate pathway to ribose-5-phosphate; facilitates the conversion of glycolytic intermediates to pentose phosphate units; also has fructose 1,6-bisphosphatase activity but this is probably not biologically relevant, since deletion does not affect FBP levels; GFP-fusion protein localizes to the cytoplasm and nucleus
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SHB17 YKR043C
CTTGAATTAAGCCGCAGCGATGTACTGAGTTCACCATCACTATTTATATCGTACCAATCG
CTTTCTGGGGCCACATTTATAAACACATCCATAAAGGGTACCTCCTTATGGTCGTGGCCT
TGGTTGCGATACGTATCCAAGACAATAAATAGGCCAGGCAGATTTTTCGGGAAGCCCATC
AGATCTGTATTATCGGCTATGACGCCCTGAGAATTCATCATGTATTGCTTTTTCGCATAC
GACGACTGTAAATTCTGTGTGAGAAACCCATTTTCGGGCGTAATGGCAAAACACATTCCA
TCACCAGTGAGTTGTGTAGTGGGGTCGTGAGAAATTCTGAAAGTGAAAACAATCTCAAAG
TCATTGATGGTGTTGTCGCCAATTCCATTGGACAATACTAATCCATGTTTATCTTGATCA
CGGTCCTGAGTCAATTTGATCGACTGAATATTCCTAATTTGCGTGGCACCGCCTACATGC
CAAAACTGGTTGATCTTGTCCAAAAACGGTATAGATAAACTAGCATCATGGTTGGGCACA
CGCGTTACATGTGATCTTCCTCTTGTAAAGGGGCTAGTCTCTGTATGGTACTGATCACCA
TTATTGAGATAAATCTCAGCCACTAATTGGAATATTAGAAACAATGATAAAATCAATAGT
GATATGGCTAGTTTCTCTGCCCTTACATCTCTTGACATCGTTACTTAAAGAGAGAGCACA
CACGTTATAAACTACCCACCGCCAAATTGCTATCCAATGTTAAGGATAGACAAATGCAAA
AATATATAAAGGAAACCAAAATCTGCTTATATAAAGCGTAAATCTTACATTTTTCACTGC
TTACTCACTCTTATTGTTTTTTTTCTGTTCAACCACGCGATGAGTTTTTTTTTTCCATTA
TTATTTATAGGACAAAAATGAAAAAATATTAGCTCAGATAAGCACATTTTGTTCATAGCT
AAGTGGATAGGGAAACACCTACACTTAATTGCAAGCAACA
Chr coordinates Chr XI from 521712-520897
w3c xhtml validator w3c css validator