Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RHO4
Systematic Name YKR055W
Strain S288c
Description Non-essential small GTPase of the Rho/Rac subfamily of Ras-like proteins, likely to be involved in the establishment of cell polarity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RHO4 YKR055W
AATGTTTGTTTAAGAACCAAAAACCATTTGTTTGCAATGCTTTGTAAAATGTTCAAAAAT
CTCATACTTTCCAAATCATTACTAGGAAGGTAGTTTGCATAATCATGTGAAGTAGCCCCT
TTTGATACAGCCAATTTGATAATGCTAGGGACCATCGCTAAAAGATCTGGCGTTTCAATT
GAGGTATGTAACTGTTGAAATTGTTTAGAAATGTCGTCAAGTTTCCTCCTCGTTTTATCT
ATAGTTTCGACAGAATATGTCTTTGTATCTGATTTTATCAATTGGCCAAACACAGACGAT
ACGCCATGTGTGATAATTGAGGCCAGGTTCCCCGCATTTACTGGACCAGGTAAGTATATG
GCACTTATTTGTGTTGCAATCGGTTCTGCATCCACAATAACACTTCTAGATTTAATAATT
AATAGAGTAGAATACTTTTTATTCGCCAAGTTGGCATCATATATAGCCTCTTCACCAATG
TCTATTGTAACTATTGTTCTATCCAGCTCTTCAAAAAGGAAGACAAACAACGTGTCGAAC
TCTCTCCCATCCAATAATCCCAAAAAAAATTGAAACCGTTCAAGGTATTGACAATGTAGA
TAATCAATGAATGCTTGCTCATTCTCTTTGGGAGAATTCTTTATACCCGTTACAGTAGCT
GCAACAAATTCTATCAGCTCATTAGCAAGTCTTGCCTCATTCTTGCACATTGCCTAAAAA
ACGTTTTGACGTACTTTCCAATTTAAGCTCTGAACGAGTATTATTGCCCTTCTATGTTCT
ATGCTTTCTGTTAATTTTTATATGTAATGTTTGTTTACCTTTCATTAGCTTATTTATTAG
AATCCGTACAATGCGACCTTCCGCGCATCAATTCGGGATGATCTGATTAAGTAGTTATAG
CCTTACGTTAAGACGACAAAAGACATGATAAGCATCCCTCAAAAGTTACAGCAAACTTAA
GTCAAATAGGTCCAAAAATCTCCAATAGTAACGCTTTTTC
Chr coordinates Chr XI from 548216-549091
w3c xhtml validator w3c css validator