Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RHO4
Systematic Name YKR055W
Strain S288c
Description Non-essential small GTPase of the Rho/Rac subfamily of Ras-like proteins, likely to be involved in the establishment of cell polarity
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>RHO4 YKR055W
ATGAATACACTATTATTTAAGCGAAAAGGTGGCAATTGTGGGAACGAAAGTAACATAGTT
TCGCAGGGATCGCCCTCAAGTAGCAATCTTCCTGAATCACCTGGCACTTTAGATGAAAAG
AATCTTCCCAGATTGCCTACTCCATTCGCTAGAAGCCTTTCTACCATTCCTAGTTATGAG
CAGATGAAACGTACAAACAAACTGCCAGATTATCACCTAAAGATTGTTGTTGTGGGAGAT
GGCGCTGTAGGGAAGACGTGCCTGCTGATATCTTATGTCCAAGGAACATTTCCGACTGAT
TATATTCCTACTATTTTCGAAAATTATGTCACAAACATAGAAGGACCCAACGGTCAAATT
ATAGAATTGGCATTATGGGACACTGCCGGCCAAGAAGAGTATAGTAGACTTAGACCGCTT
TCATATACGAATGCAGATGTGCTGATGGTGTGCTATTCTGTTGGTAGTAAGACATCGCTT
AAAAATGTGGAAGATCTCTGGTTCCCAGAGGTTAAGCATTTTTGTCCTTCCACTCCAATC
ATGCTAGTCGGCCTTAAATCAGATCTATATGAAGCTGATAACCTTTCAGATCTGGTGGAA
CCAAGTTCAGCAGAATCCTTGGCCAAGCGTCTGGGGGCATTTGCACATATTCAATGCTCA
GCACGATTGAAAGAAAATATCGATGAAGTATTTGAAACTGCCATACACACGTTACTTTCC
GATTCATTATATGCTCCCAGAGAGCCTACACATACAATCAAAAATCCCTTTAAAAGAAAT
ACCACCAGATCAGATATCGATTCTTCTACTGGAGATACCAGCGTCTCTATTTCCGGAACG
AAAAGATTAAGAAAAAACAAGTGTATTATAATGTAA
Promoter Sequence
Download FASTA
>RHO4 YKR055W
AATGTTTGTTTAAGAACCAAAAACCATTTGTTTGCAATGCTTTGTAAAATGTTCAAAAAT
CTCATACTTTCCAAATCATTACTAGGAAGGTAGTTTGCATAATCATGTGAAGTAGCCCCT
TTTGATACAGCCAATTTGATAATGCTAGGGACCATCGCTAAAAGATCTGGCGTTTCAATT
GAGGTATGTAACTGTTGAAATTGTTTAGAAATGTCGTCAAGTTTCCTCCTCGTTTTATCT
ATAGTTTCGACAGAATATGTCTTTGTATCTGATTTTATCAATTGGCCAAACACAGACGAT
ACGCCATGTGTGATAATTGAGGCCAGGTTCCCCGCATTTACTGGACCAGGTAAGTATATG
GCACTTATTTGTGTTGCAATCGGTTCTGCATCCACAATAACACTTCTAGATTTAATAATT
AATAGAGTAGAATACTTTTTATTCGCCAAGTTGGCATCATATATAGCCTCTTCACCAATG
TCTATTGTAACTATTGTTCTATCCAGCTCTTCAAAAAGGAAGACAAACAACGTGTCGAAC
TCTCTCCCATCCAATAATCCCAAAAAAAATTGAAACCGTTCAAGGTATTGACAATGTAGA
TAATCAATGAATGCTTGCTCATTCTCTTTGGGAGAATTCTTTATACCCGTTACAGTAGCT
GCAACAAATTCTATCAGCTCATTAGCAAGTCTTGCCTCATTCTTGCACATTGCCTAAAAA
ACGTTTTGACGTACTTTCCAATTTAAGCTCTGAACGAGTATTATTGCCCTTCTATGTTCT
ATGCTTTCTGTTAATTTTTATATGTAATGTTTGTTTACCTTTCATTAGCTTATTTATTAG
AATCCGTACAATGCGACCTTCCGCGCATCAATTCGGGATGATCTGATTAAGTAGTTATAG
CCTTACGTTAAGACGACAAAAGACATGATAAGCATCCCTCAAAAGTTACAGCAAACTTAA
GTCAAATAGGTCCAAAAATCTCCAATAGTAACGCTTTTTC
Chr coordinates Chr XI from 548216-549091
w3c xhtml validator w3c css validator