Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name KTR2
Systematic Name YKR061W
Strain S288c
Description Mannosyltransferase involved in N-linked protein glycosylation; member of the KRE2/MNT1 mannosyltransferase family
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>KTR2 YKR061W
CCCCGTATTATTCCATTAACAAAGTACAAGCTATTTAAACCAAGGGACCTAAACATATTA
CTCATTACCAAGGATCCCTCTGCCTTGTATAGAGAAACTTTGACGAAAGACGAGCATACG
TCGGAATTATTCAAGGAAATTATAAGTGTCAAGAACTTGAGACGTAGATTCAAAGGGAGT
AAACTGACCCAACTTTATAAAGATTTTGACTTGGTCGTTGCCGATTACAGAGTTCACCAC
TTACTTCCGGAGGTTCTTGGTAGCAGATTTTATCACGGTAGTAAAAAATTGCCATACATG
ATCCGCATGTCGAAAGAAGTAAAATTGAAGCGTCAACAAATGGTCGAAAAATGTGACCCC
ATTTACGTGAGAGCACAATTGAGAAGTATATGTAAGAATACCTCATACATTCCCAATAAT
GACAACTGCTTAAGCGTCAGGGTCGGTTATATTCAAAAACACTCCATACCAGAAATTTTG
CAAAACATCCAAGATACAATAAACTTTCTCACTGATAAAAGTAAGAGACCGCAAGGCGGC
GTCATTAAAGGAGGAATAATATCTATATTTGTCAAGACCAGTAACAGTACTAGTTTGCCT
ATATATCAGTTTTCAGAGGCTAGAGAAAATCAGAAAAATGAAGATCTGAGTGATATTAAA
TTGTAAAATTAAAGCATCATCTTTTAAATACGGTATTTAAACACTCCCAATGAAAAAGCG
TGATTTTGTCTAACTAATTATAGCATTAATAAAGTGTTTTAAACTTTAATTCCTTTCAAG
AATTTGCAAGATTATAGAAATTTAGTAAGCGAAAAAAAAAAAGAAAAAAAAAAGAACAGA
CACCCTATAAAAATAGAATAAACATAATAAGCCACCATTTGCCTGTCTGATGATATTCTT
GATTCTTTATATCTCTTCAGGTATGTGACACCTATACATGCAACGCTTTTTTTGCGTTTT
TTCTATACAATAGTTGTTTATTTAAAAGCGTAGGAGCTTC
Chr coordinates Chr XI from 557677-558954
w3c xhtml validator w3c css validator