Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GPT2
Systematic Name YKR067W
Alias GAT1
Strain S288c
Description Glycerol-3-phosphate/dihydroxyacetone phosphate dual substrate-specific sn-1 acyltransferase located in lipid particles and the ER; involved in the stepwise acylation of glycerol-3-phosphate and dihydroxyacetone in lipid biosynthesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GPT2 YKR067W
GCAATCGCATTGTACACCTTTTGGAAGTCCTCGTATGACCTCCCTTTTTCGACAGAGGCG
ACATGAACGAGCGGTGTAGTGGAAGCCAAAGCAGCTGCCTTCCCCCAGTTGTTCCATCCG
TGGTTACTACCACCCCCGGGAGAAGACGATGATCTCTTTTGGGATTGCGAGTAAGCAAAA
GTTGCAGCAGCAGCAGCAGCAGCAGCAGCGGAGAACAGGTAGAGAGACCTCTTATGGGCG
GTTCTGCCCAGTGAAGGTAAAAGCCTAACAGCAGTAGTCATAATTGTAGATATACGTGTG
TGTTTGCGTCTGCATGAATGCGAAATTCATGTTCTTGAGTTAGCGAGCGTGTACAATAGT
CTCTGCTTAAGTACTTTTCGCTCCAGGGTCCTTTCCTAAATTGGTAACAGCCGGCTTGGG
CCGGCCCCTGGATGCCAAGAGAGTCATATTACTCAGTACTCAGGACCAAATAACTCATCG
CTGTCGTTGGTAAAGAAAACTACAAATCTGGGCCTGACCATGGTTTACGAAATTCCTGAC
AAAGCAGGATATTCTTTGGCTTTGGAATTTCCATTGGCGAGATCTAGCTGCGGGAGAAAT
CATCCCGACATTATGTAAGCTACATAGGTCGCTGAAGTGTAGTCGCCACACGGCAGCGCT
AAATGATAACTAGTAATTGGTGTGGAGCGACCACATTTTCGCATCGATCCAAGCTCGTCT
TTTGGCTTTCTTGGCTATTCTTACTAGTTATATTGAATTATTACAGCTCTTGCTGGAACA
CCAGTAACCCGCCGTTGCTCCGCATTTTCGAAGTAAATGGCTCACTTTGATTGTAAGGTT
GAGAGGAGTAATAAAGAGGGGAGAGAAAAGAGGAGAGACCCTGAAGAAGTGGCAGCTTGA
GTATAAGATAGTGTCTTTTCGTGCTTCGTCGCTAGAGCAAAATTCTACTTTCACATCTAA
TAAAGCCGATTAATCGATCAGTTATTGCTCCCTTTCCTTT
Chr coordinates Chr XI from 567918-570149
w3c xhtml validator w3c css validator