Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YKR075C
Systematic Name YKR075C
Strain S288c
Description Protein of unknown function; similar to YOR062Cp and Reg1p; expression regulated by glucose and Rgt1p; GFP-fusion protein is induced in response to the DNA-damaging agent MMS
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YKR075C YKR075C
AAAACGTTTCCGCGTCACTACATTCGTCACTACACAACTTTAAAATACCTTATTTTTTTA
ATTATGCGGAGTAAGTATCTTTGCAGAACTAGATGGTTGGATTGAGCAGTAGGCATCAGT
GACTCGAATTGGTGCTCATTTTTATTTTAACGTACGATTTGTTCAGGCCTTGCTATGACA
AGCTTCCTGACGAAATCATACTGCAAGATACATAGTCCCAGTCCATAAACTAGTAGAATG
ACAAAAAGAAACTCAGAACATACATAACACGATAGACAACGTATTCACGGTTTTGAACCC
CACGTAGTATCCTTCTAAATGGCATTGCCTTTACCACATGAAAAACTAAGAGAAGAAAGC
TCTCTGCACTAATCATTATAAACGACAGCGGACCCGGAAGCGAGTACCCGAATAGGCCGG
GGAAGGAAAAGATAGAAAGGAATCTTTTTTTCTTCCCCCCGCTCTTTTTTTTTATGCTTT
TTGGGGTTTTTCCGGCAACTTTCAACAGAAATGCCGTAGCCGGAAAAACCGAAAGCGGGG
GACAGTGAAGCGTGAGAGGGGCGAGACAGGGGGAACTTGAATGGGGTATTTTGCTTTTGC
TGCATTTTTTCCGCTGGTACCTCTATCTTTAGGCGACCGGAAAAATTCATTTTCTCATCT
TTTTTTTTTTTTCGTTTCCGACTCGATACTCTTTACAAAGAAACCCCCGCGGGGAAATGT
TAGATTTGAGCTTTTTCCGCCAGGAAAAGAAAAAACCTGGGGACATTAATCTTGTTTTTT
CTTTCTTCTTTTGTCTTCCCTTGGATGACTGCAGAAAAAGTACAGTTACCGGGTCTTAGC
AAAAACAAACATATATATATATATATATGAAAGCGTATGGTCAACACGGTTTTATAGGTT
TTACTTTTTGCATTCAGTTCAACTTTGGCCCTTTCTCTTATCGCATTCAGATACTACACA
CAAGTGTTCATACACACACAAATAGATACATATACAGAAA
Chr coordinates Chr XI from 580750-579827
w3c xhtml validator w3c css validator