Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ECM4
Systematic Name YKR076W
Alias GTO2
Strain S288c
Description Omega class glutathione transferase; not essential; similar to Ygr154cp; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ECM4 YKR076W
AAAAGAGCGGGGGGAAGAAAAAAAGATTCCTTTCTATCTTTTCCTTCCCCGGCCTATTCG
GGTACTCGCTTCCGGGTCCGCTGTCGTTTATAATGATTAGTGCAGAGAGCTTTCTTCTCT
TAGTTTTTCATGTGGTAAAGGCAATGCCATTTAGAAGGATACTACGTGGGGTTCAAAACC
GTGAATACGTTGTCTATCGTGTTATGTATGTTCTGAGTTTCTTTTTGTCATTCTACTAGT
TTATGGACTGGGACTATGTATCTTGCAGTATGATTTCGTCAGGAAGCTTGTCATAGCAAG
GCCTGAACAAATCGTACGTTAAAATAAAAATGAGCACCAATTCGAGTCACTGATGCCTAC
TGCTCAATCCAACCATCTAGTTCTGCAAAGATACTTACTCCGCATAATTAAAAAAATAAG
GTATTTTAAAGTTGTGTAGTGACGAATGTAGTGACGCGGAAACGTTTTACTCGTCAATGG
ACATTTGCGAATGTGTCCGATAAATAGTTGAGGCTTTTCCTGCATTCTGTCAAGAAGGGT
ATGTGTATGAACATGCAAATGACACTGTAAAATGATTCATTACCCTGATTATGGAGTGAT
TTTCTTTCCTTTTTTTTTTTACATTTAGTTTCATTATTATGCAAATTAGAGGGTATACAG
TTGAGATTTTAACACTTTGAATTAAAAAGTGTTACAGAGGAAACCGACGCAAAAGGCTTG
GTGACGCAAACTTTTCCATCTTTATTTCACCTCTTCAGACGGTCCTAAGACCTTTTGAAC
GTATCAATATAGTTTTATCATCTGTTCTCTGTTGTTCTCCGTTACTAAGATATTAGTCAG
CTCTTGAAATTTCACACCCCTATTTATTTGTCTTAGCGTCCAACCCCTCTCAACCCTTTT
CCATTTCTTGTATAAAGGTAGTTAATTAGGTAACGCTGCTCTTACCATCACTACAGTGCT
TACGAGAATTTACCCAAACCCTGCGCAAGATAAATAAGAA
Chr coordinates Chr XI from 582283-583395
w3c xhtml validator w3c css validator