Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MTD1
Systematic Name YKR080W
Strain S288c
Description NAD-dependent 5,10-methylenetetrahydrafolate dehydrogenase, plays a catalytic role in oxidation of cytoplasmic one-carbon units; expression is regulated by Bas1p and Bas2p, repressed by adenine, and may be induced by inositol and choline
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MTD1 YKR080W
TCCTGACCAAATGGGAAAATGCAGATGAGAAGGATTTCAAGTGTGAATGACTATTTAGTA
GTATATTCGACAGTTTGAATTATGCTTGAGGAAGATTATTTCACTGCCGCTCTATATCCT
TTCGGGTATTTTAGAGAGAGAAAAGGAGGCAAAAAACAACCACCTAGACAGAATCATTAA
AAGGTGGTATGAACTGCCGAAAAAGGGCCCAAGACAAGGTTTAGGATGCTAATTATGTCT
TCCCTTTACGTCAGTTATAGATTATGCGATGCCCAAAAATTTTTTTCACTGCGGGTAAGT
GTTCTGAAATACCGAGCAGTTACTATGTAGAAACGCTACGTCCTCGTTTGAGATATCAGT
GGGCGATATTAATGCAACCAGGAATACCGCAACCCCATTACAATGGCCTAGCAAACATTC
TGTAACAGCAATTTTGATTTGTTGAGTGGGTTGCTCTTTTTTTTATAGCATGACAATGAT
ATCCGTAGGAACAGTGACATCGTATTTCAAATATGCATTCGAAAAAAAATAACCCAACTG
AGGCTGTAGTATATTGTTTATGCAGGCTGTCACCTCCATAAATTGATATTTTATGGCATT
ATTCGCTACTCCAAGGTACCCTAAGAGGCCCTACTTTTTTGCGAAAAACCCCAAGACAAT
TTATTCTTTTCCTAGTCCAAGTCCTGACAAAAAATGAAAGCCCTGCGACTCTTTTTGGCG
GAGTCAGCCCGAATCAACACAAGCCCTAATATTCCCAATGAACTGGTAAATAGATTTCTA
CAACGTTGTAAAGACTAATATTACTGTCTTTACTATTATGATATATTGACTCAGTAGAAA
AGGAAAAAAAGCAACTACGCAAAGTATTTAAGTGCCTTGCAACCAGCTTCTTCTTGGGCT
GAGATACAATACCTCCTTGTCTATTCAAGTGTACAGTATCGCAAAGCACAGTAAAATTAA
TTCCTATCAACACAACCCATCAATATAAATCTATAGAGAA
Chr coordinates Chr XI from 590395-591357
w3c xhtml validator w3c css validator