Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PTR2
Systematic Name YKR093W
Strain S288c
Description Integral membrane peptide transporter, mediates transport of di- and tri-peptides; conserved protein that contains 12 transmembrane domains; PTR2 expression is regulated by the N-end rule pathway via repression by Cup9p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PTR2 YKR093W
GCGAACTTTTTTGATACAGACGTAGGAGGTAGCCGTTACCGCATTAGTATACTATATGCG
TACGGCCGCCAAGAGCCCAAGAAAGAGACACAAAACTACGTGGGATAAGCTTGGGGTAAC
GCAATCAGTATTGTTCATTTTTTTTCCCGGAAAAGCTAAGAGTTTTCTGGCGAGATAAGA
TAACGGCGCCGAAGGCAGCGGCGAACTGACTTACCTCCGTCGGCTCCGGCGTACGGCACC
AAAAAATCCCGCAATAACTTGACACCAATGGGCTAACGGCGTCCGCAGAACCGTGACGCA
ATCTGCGGTTTGTGTCAAGACAGAGAAGTGGGCTGCTTCTCCCCTTTCAACACTCCCCTC
CCATGGCTGAATACTCAGACGTTTTCTGTGGTGGAAATGGCATCAAAAGTGCCACTGGCT
GGCGAATCCAGACTATTTTGTGTCAAAGAAACATGCGTACCTGCACAATAAAAAGAAAAG
GCCCGCCCTACTGACATCCTGTTCAGGATCCTCGAAGAACAGGAAAAAGGACAACCGTCC
TTTTCACTTCACGTTCGCAGGGCTTTCCTCGATATAATGGCGATTACACAAGCGGTGGCG
TCTTGAAAAAAGTTGGGTTTCTTATCTGTACGGCGATCACTCCCCTCATATGATAGCTGT
GTAGAGTGACTTGCTCTTTGATTGGCCTTACTTCTTGCATCTATCATCCTTTCTTTTACT
CTCTCCAATCACCACAACTCATATCATTCTACATTTCATTTTATTGTTCTGTACAATTTT
TAGGTTTGTAAAATATATAAGTGATGTACATATCTTCTATATCCTTTCCGTTTGTGTCTA
TTTTAGGGTTGGCTTATTACGCATTATTCCTACTTTATTTTTACTTGCTTACTTGAAAAA
GAAGGTATACCACAGTGCTGCTCCACTGCAAACAATATAAAATATTATCAATTATTTTTT
TTTTTCTTCTTTTGAATTAGATCACTAATAAACTCTTATA
Chr coordinates Chr XI from 615730-617535
w3c xhtml validator w3c css validator