Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL40B
Systematic Name YKR094C
Alias CEP52B, eL40, L40B, L40e, UB12, UBI2
Strain S288c
Description Fusion protein, identical to Rpl40Ap, that is cleaved to yield ubiquitin and a ribosomal protein of the large (60S) ribosomal subunit with similarity to rat L40; ubiquitin may facilitate assembly of the ribosomal protein into ribosomes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL40B YKR094C
AAGTCCTAGTCAGCACAAGAGATGGAAAAATAGACAGGCAGCAATATATCTATCAGTAAA
TATTGTAAATGGAGCGTATCTCTCCGGCGCCGTAAGACTCAATGGACCACTTTTATTGAT
ATCTCTGTCTGTATTCAATTTGCCTTCCAGTTTTCTTTTCCCATATACTCTTGTTGTCAT
GTCAAGAGGAATGAAAGGAAACAAAGATGGGAAGAGCGCGTTACCCCGCGCGTCGATCAT
CATATTATAAAGAAGACTTAAGTTATTATTTTTGTCAGTAATATTCACCCTGATATAATG
TTAGTAAGAAGTAAATTTTATTATTCCATATAGAATCTATGGAAGGTTGACCCATCCCTC
AATTTTTTCTTGAGAGTAGAAAAGCTTTCTGCGATATGTGGAGAGATATAAAAAATGCTG
GTTCAGTTCAAATAGAGAGAGAAATTTTTAAATTCTTGCATAGGGATACTTGAATTCATT
GCTTGAGATATTAACGCGTTAGGTTGTGTTCTTCAATGATGGGCAATGCAATTTGGCGTT
AAGCGCCTGAGCAATAAGGTAACAGCGAAATTTATGACATATTATTTCGAACCTTTTACA
AACTAGTAGATTTAGTGATTTATTACCTATTGGCATTCATTTGTGTTCTATATGTGGATG
AGGATAGCCGCCTTTCTTCTCATCGGAGGCCATATCATCTTTCGACAATCCTTTTTAAAT
ACTATTTCCATCCGTGCCTCTAATAGATTTGTGTAGTTGTCTGGGTGCAATCTTTCCATT
TTTGCTGAACTTTTTTTTTTTTTTCATGTTTTTCAGATTCTGAAGTACCGCAATAGGATA
TGGCGGATAATCCGCCATATGATCCGCCTCATACTAGCCATTACCCATCTATCCCAGGCA
TTATGGGTATGCAACTCATAATCTCAAATACACAAATAAGAGCAACCTTATATATCACTT
TTTCCCGTTCAGCAAGAGGTAAAGCCACCAAAGGTTCAAA
Chr coordinates Chr XI from 618374-617996,618750-618743
w3c xhtml validator w3c css validator