Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VBA5
Systematic Name YKR105C
Strain S288c
Description Plasma membrane protein of the Major Facilitator Superfamily (MFS); involved in amino acid uptake and drug sensitivity; VBA5 has a paralog, VBA3, that arose from a segmental duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VBA5 YKR105C
GCACCAACAACACTAGAACTCATCCGATAATTTATTTACTTGATTATTCTTTTTTTTTTT
TTTCTCGTTCCAGTCCATAAAACTATTTTACTTTTCTTATTTATGTAAATAGTATTTAAG
ATTCTACGGTCGCTACATCTGCTAGAAATGGAATTACTTTAATACATTCCATGTTCTCAT
ATATATTTTACTGACACATTTTGTCACTATTTTTTTTTTAACTTTTTTTTGGAAGTACTA
AAATTATATGCTCGTAATTATTGAGTATCAAAAAAAAATAAAAAAAATTGCTGTGACGCC
CCTTCAATGTGGTGTCTATACACCTGGTGACTTTAACTTTAACTTTGACCTGTCGTCGTA
CAATCAACTTACTTTCCGAAAATCCACAACGAACCAGTTATACCGAAGACTTTTGTACGA
CAAGAATACTGTACCGTCGAAACTATCTCTTTTCAAACTAATGAGTGAAGCTTGTGTTTA
TGTCTGTTGAAACAAGGAAAAAAATGCGGTGCCTGTCGACAGGATATGAGCACAAGTGCA
AAATCATCAAAAAATTGAGTACCTAGATCCGGTGGTGTAGGACGAGCAAAGTTCCTTCAT
AAACAAACCGTAAGGGTTACTGATACACAATTTCCTTTGTGTAAAGAGTATTTGAGCAAA
TTAGTCGGCGATTGAAAGCAACACCCTTTTTTCTATATATAGTAGGTGAAAGTTAACATG
CGAGTAAAAGTAGTGCCACATTTCCTTTGCAGCAGGTGCAAATTAGTACATATTTAACAG
ATAGCGCCGCACCTCATATGCAGCGCGTACATGATACGAGTCGACAAAATATGCAAAAGA
TAATAGTGTCATCACACCTTTATGAGAAGCGAATTTTTTTTTTTTTTGGTTTAAATATAT
ATATACATATATATAGATGTATTCTAGTTATACTCATACCTAGAACTGATCAGACCAGAT
CATACCTGGTATAGAGCTTAATCGATAGAAATTCAAAAAT
Chr coordinates Chr XI from 660464-658716
w3c xhtml validator w3c css validator