Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SPO75
Systematic Name YLL005C
Strain S288c
Description Meiosis-specific protein of unknown function, required for spore wall formation during sporulation; dispensable for both nuclear divisions during meiosis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SPO75 YLL005C
TTCTTCTGCATCAGCTGCGCTGTAAAGTTTGTACATAGACCTACGAAGCATCATTCTTAC
ATTCGGAGATTCTTTCGGAGTCAATTCAATCAAAACGTTGTAGCGAGAAGATTCGTCTTT
AAGTTCAATTTTTGTCGTACTATCTGAACCTAATAGGAAAATAGTGTTAAAGCATCGCCT
TTTCTGAGTAGTTTCACTATATAAAAGGTCTGAAATCTCTGCTTTCAAGTCTGCTTCAAT
ATTATCGATAATATGATCTACTTGATCATGAAAGTGGGAATGTAACTGATGATACAATTC
CCATCTTTTTTCCACGTTCACTTCCGATTCTTTGCCTGATAGAAGTTTGACAAAGGGAAT
GTGTTTATCATTTTTGTTACTTTGAGGCAAACTGGGGTATACTGTATAGTGGCTCCTTTG
GGCGTCAGCAAACTCGCTGACGTTCATCTTTTTGGATTGGTTAAGGTCGCTCATCCTGTT
GGACTACTCTTGTGATACTACGACTCTGTATGTAAACAATGCCATCTTTTGTCACTTTTC
TTTTTCTTCAAATTACGGTGCGGAAAAATACGTCAGTAAATATCAAAAAGACACTAAAAA
AGGCGTTAGTGGTAATGGAAGGTAAAAAAAATTCTTACCATCTAACAGAATGCTTAGTTC
CATTATCATCACGTGTAGCGTTTCTGCTGGTCTTACTAAATATAAAGATAATAAAACAGC
AGGTAATGAAACATTACTCTTGTGAAATTGTCAAGCCTGTCTCGTAACGCAACCAACGAC
AACCCTTCATCTCCAGTATAGTTTCAAGTTTCTGGAAAAGATTGTCTTTTCCACCTTTTT
TTATTTTTTTTTCCTATTAAAAAAAAAGCTATTCTACAAAAAATTCTTTATGACACAAAT
TATAGCGTGTTTAAAAATTAAACAAATGTGCAAAGTATATTCACAGTAGACAAACTTCAG
GAACTCTTTTTCAAAAACAAGAAAAAGACTTACCAAGAAG
Chr coordinates Chr XII from 140546-137940
w3c xhtml validator w3c css validator