Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YEH1
Systematic Name YLL012W
Strain S288c
Description Steryl ester hydrolase, one of three gene products (Yeh1p, Yeh2p, Tgl1p) responsible for steryl ester hydrolase activity and involved in sterol homeostasis; localized to lipid particle membranes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YEH1 YLL012W
TTGCCGTGGTGAAACTCGACCTTCTGAAGCCGCCAATTTGCTGTGATCCAGCAGCACCGC
CGTTCACAATGCCGGCCGCGGCGGCCTGACCGCCGTTGTTGTTACTATGGGACAGGGCGC
TTAAAGAAGAAACTATGGATGCGAGTTCCATATCCATATCCATATCCATGTTCATTTCCA
TTTATACCCGCAATATTGCGTTATTCAGAAGAAATTTAAATGCGTAGTTCTTGTTTGTTT
TCTTGTTTGCTTGCGTACTTCTATGCTTATAGATATATCAGTAGCAAGGAAGTTTCCTTT
TCACCGCCTTTCAATGTTCCTATCTTTTTCTTATGTTTCTCTTTAGAGACCAGATGACCA
GAAAAAAATTAGCTAAGCAGTGTTATACTATTTACAGTAGATATTCAAATATGTGCAGGC
ACCACTTATTTTTCTTTTTCCTTCTTTTCTTTGTTTTTTTTTTTCTCCTATTCATCAAGC
TTCATACATCCAATATACATTCTCAAGTGTGCTAATGGTACATTTGGGAAATTATCTTCC
TCTCTCCACAATTTTTAGAAGGAAAAAAGAAATGCAGTTCAGGGTAACAGAGTGCGCAAT
TACCGTAGATAGCGATCGGATGTTTATCTTTAGCCCTCTTTTTCTAGCTCAAACCCCGGC
ACGAATTTTTTAGGTCTTGCTGCTCTGCCCTCGGGCACTTTTCTTCGAGAAGTTCTGGGG
CGGTCTGATCGGGAAAAAACGTTCCCTTTTCGGACGTATCGCAGGCAATGTGCAAAAGCT
TATTATATACGAGAAAAGAAACGCGAAGGAACGAAAGAAGATGAAAAAAATGCAGCGATA
AAATGATATTGTGGTTAATCTAAATTTATATATATATATATATATACATATATATATAGA
AATCTATTGTTATACACAAAAATACTTATTTTTTAATATAGATGGCTGCAGATAAAGTAA
TAGTTTTATATATAGGTATATTTACTGCACAATTCACACG
Chr coordinates Chr XII from 125534-127255
w3c xhtml validator w3c css validator