Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HIF1
Systematic Name YLL022C
Strain S288c
Description Non-essential component of the HAT-B histone acetyltransferase complex (Hat1p-Hat2p-Hif1p), localized to the nucleus; has a role in telomeric silencing
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HIF1 YLL022C
TGCCTTCGGCAAAAGGTAATCTGGTTGGTTAGCATCTTCACCGATTCTCCTCTGCAGCTC
ATCGGACACGTCTGTACTCAGCTCGTAAAATTGCGAAGAAGATAGCTTCAACAGCTTGGC
TCTGGCCTTTTGAGCTCGTGTCGAATTTGACCTGTCACGATTTTCGCCAGTCACCTCGAA
AAAAGTCTTCAGTGAGACGTAGTAATGGAAGATATCTCTATGATGTGCGAGAGAAACCTC
GCTTGACGTACCCATGTTTACTCTTTCTTTTCTTTTGTTTATTCTGTTTCGGTGGCTCGT
ATTGCGTTATTCCTCACGCCTTGATTTGAATCTTCGTCTCACGTGGTTTCTCAGCGTCTT
TCACACGCTTCTGACCAAATTTATCTTACCGAACTATACGTAGCTATGTGTTGCTTTCTG
CTGAAAGAACTCGATAATAGAATATTATTCTCAAAATACTTCAAAGTTTATTCTCATCGT
TTCCAAAAACGCGTCACGCATCACCCGGCGCAGTATTTCTTCTTCCTTTTCCGCCATAAA
AAGTCATAATAATAAGCCTATCTCAAGATTCTTATACTACTTTTAACAGTTTTATTGATA
ACTTACTTACGTTAGACCATCTTTTTTGTGCAAACCTTTGGTAAAAAAAAAGAACTGCGC
TACCTTCTCCTAGTTTATGTATGGTACGGCAACTCATAGTTAGTTTTCTGTGCCCGTTTT
AAGCACGACTTGAACTTACGTGATTATATGTATACAGTGCATGTTTTTATATAGAAAAAT
AAAAAAATGGGGTTACGTAGTCGAAGGATATAGCAGTGTCTAAAAACTTGCAAGAGCACT
CGTAGCTCCCCGGCAGTGGAATCTTACCACTTCTCAGAGAATGTCGGAACGATATGTTAC
TGCACTGAAGTTTCGCGTTTTTTCCAATTTTGTATTATTTCATTCTACTCAATTTTGAGG
TAACATCGGCGATGAGGTCTCCTTCTAGAAGTAACAGAAT
Chr coordinates Chr XII from 100201-99044
w3c xhtml validator w3c css validator