Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ENT4
Systematic Name YLL038C
Strain S288c
Description Protein of unknown function, contains an N-terminal epsin-like domain; proposed to be involved in the trafficking of Arn1p in the absence of ferrichrome
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ENT4 YLL038C
GCTATTATTTCCAGAGGGCCTTGTAATCGTTTGCTACTACTATATCCAGGTAACCAAATA
ACTATATTGGACTCAAAAACAAACAAAGTCCTCAGAGAAATAGAGGTAGATTCCGCCAAT
GAGATTATATATATGTATGGTCACAACGAGGTCAACACAGAGTACTTCATCTGGGCGGAT
AATAGAGGAACCATAGGATTTCAATCCTACGAGGATGATTCCCAGTATATTGTTCATTCT
GCTAAATCAGATGTTGAGTACAGCAGCGGTGTCCTACATAAGGATTCATTATTATTAGCC
CTTTACTCTCCGGACGGTATATTAGACGTTTACAACTTGTCATCACCTGACCAGGCAAGC
TCTAGATTCCCCGTAGATGAAGAAGCCAAGATAAAAGAGGTTAAATTTGCAGACAATGGG
TACTGGATGGTAGTAGAGTGTGACCAAACTGTGGTTTGCTTTGACCTAAGAAAGGATGTC
GGCACGCTAGCGTATCCAACTTACACAATCCCAGAATTCAAGACGGGCACCGTTACCTAT
GACATTGACGACTCTGGAAAGAATATGATTGCATACTCAAACGAGAGCAATTCGCTGACG
ATATACAAATTTGACAAGAAAACAAAAAATTGGACTAAAGACGAGGAGAGCGCCCTCTGT
TTGCAAAGCGACACTGCCGATTTCACTGATATGGACGTGGTATGCGGAGATGGTGGTATT
GCCGCTATTCTGAAGACAAATGATAGTTTCAATATTGTTGCATTGACACCCTAAATACGC
TGACACGTTTGTACTTTCTAAATAAACCTGTGTAATAGTAGTAACATTTCCAGTAAAAAT
TTCATTTCCTTCTCTTTTTACATCTCTAGGACAACGCTTTAGTGAGAAAAAAAAAAAAAG
AAAAAAGAATGAGAAAACGAAAATTGAGGTTATGTGTTGAATAAGCCTAGAAAGCATAAA
GGTGTCAAAGAACGAGTACACATATAGTGAGGGGGTCGTG
Chr coordinates Chr XII from 66518-65775
w3c xhtml validator w3c css validator