Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SDH2
Systematic Name YLL041C
Alias ACN17, SDHB
Strain S288c
Description Iron-sulfur protein subunit of succinate dehydrogenase (Sdh1p, Sdh2p, Sdh3p, Sdh4p), which couples the oxidation of succinate to the transfer of electrons to ubiquinone as part of the TCA cycle and the mitochondrial respiratory chain
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SDH2 YLL041C
GGCCAAGGGCCTGTCAGTTACACAAGATCTGGAATTCCAAAGGGTCAGGAGATTACAACA
AAGAATAAATAAAAACAACAGGAATGCCTTGGCAAACTCAGCGCAATCCTTTGCCAGCAC
ACTGGGAAGCGGGTTGAGCGGAATTGCACTGGACCCATACAAGGCCATGCAAAAGGAAGG
CGCCGCTGGTTTCCTCAAAGGCCTTGGTAAAGGTATCGTTGGGCTGCCAACTAAGACAGC
CATTGGATTCTTAGATCTTACAAGTAACTTAAGTCAAGGCGTGAAAAGTACCACCACTGT
GCTTGACATGCAAAAGGGTTGCAGAGTGCGTCTACCAAGGTACGTGGACCATGATCAAAT
CATCAAGCCTTATGATCTACGTGAGGCCCAAGGACAATACTGGCTCAAGACCGTGAATGG
AGGAGTATTTATGAATGATGAATACCTGTCGCACGTTATATTGCCAGGCAAAGAACTAGC
AGTAATTGTGTCCATGCAGCACATTGCTGAGGTGCAAATGGCCACCCAAGAGCTTATGTG
GAGCACAGGATATCCTTCCATCCAGGGAATTACATTGGAAAGATCCGGTCTTCAAATTAA
ACTCAAGTCTCAATCCGAATACTTCATTCCCATCAGCGATCCTGAAGAACGTCGGTCCTT
GTACAGGAACATCGCCATTGCTGTTAGAGAATACAATAAGTACTGTGAAGCTATCCTATG
ATCACATATGAAAGTATATACCCGCTTTTGTACACTATGTAGCTATAATTCAATCGTATT
ATTGTAGCTCCGCACGACCATGCCTTAGAAATATCCGCAGCGCGCAAAAGGCGGCCTCGC
ATTGGCCCAATTAGCTCCGGTGTAAAAAGGGCAAACTTATATAAGGGGATTAATGACTTT
CTATGAGAATGCCAAAAAATGTTAGGCTAAAGGAAGGGATTGAAAGGAATATAGTTGAGC
TATACTTTCTTGAAATACTGGAGTATACATATTTATAGGG
Chr coordinates Chr XII from 53931-53131
w3c xhtml validator w3c css validator