Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL8B
Systematic Name YLL045C
Alias eL8, KRB1, L4B, L8B, L8e, rp6, SCL41, YL5
Strain S288c
Description Ribosomal protein L4 of the large (60S) ribosomal subunit, nearly identical to Rpl8Ap and has similarity to rat L7a ribosomal protein; mutation results in decreased amounts of free 60S subunits
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL8B YLL045C
AAACATCTCTGAAGCATTTTAACATATATGGATCCGTCTTTCTTTCTTCTGCTAAGGGAC
GGTATTACACGACATATATTGTCAAGCGCAACAGAACTAATTGACTTTAGGACGAGAATA
ATATAACTTTATGACACTCTGCTCTCCTACTACTTCTTATGCCGTAACTCTCTCCGTCCC
TCAGTCCGTTGCTGCCTTTTTCTTGCGATGGAAGGCCCGTATCAGAATGCCCTTGACAAT
GTTCTCATGATAATGTAAGTATTCCTTCCTAAATAAAAGCATCAGCCGCGTTATCCCGCT
ACCGGGTTTTATTGTTTACGGAGAAAGCAATAACAGCATTTTTTTTGGTGTTCTTCGACT
ATCAACAAATAACCGCCGAAGCGCCTTGCGGAGGATAACCACCAACGAACTCAAATACCT
ACCGCGTACCTTCCTACGGTTATGTACTTTTGCACTGCTATTGCTTTGAGATGCTATGAG
AACTGCCGTCAAAATTGGGTGGCAAAGAGGGATAGCTTCACTGCCAATCACTACACTCTG
TTCTGAAGGAGGGGAATTACTGTTGTCTCATAAAAAAACACCTTTGAAACACTTTCACTC
ATAGAGAAGCCAAGAACTCTGATGAGTTCTTTATTTGTTGCCGCTAACTTTATCTTATCT
TCTCCATTGTAATAATTACTATTCTTTTTACTTGCCTGTTTTCCATCCCAATGAAGATCC
GTACATCTTAGACACCCTTTTCTTTTTTTCTTTTTTTTTTTTTTTTTTTTTTTTGGCTTC
CGAAGTGCCGACAACTAAAGAATTATCGCATTTTTTTTGAATACATCATACTATACGATA
GAACGCATTGAAACTTTTCCCATCTCAAAATCCAGGGACAATAGTATGGGATCGATATTA
TTATCAAGACATAAGTATTGTGATGCGCACGTTGAAATTCACTATTTTTTTTTTTTATAT
CTGTTTTTCAATACAGTGAACACGATAACTGAAAGAAAAG
Chr coordinates Chr XII from 48629-47859
w3c xhtml validator w3c css validator