Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YCT1
Systematic Name YLL055W
Strain S288c
Description High-affinity cysteine-specific transporter with similarity to the Dal5p family of transporters; green fluorescent protein (GFP)-fusion protein localizes to the endoplasmic reticulum; YCT1 is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YCT1 YLL055W
GTATACACTATGCAACACCCTTCGCAATGGCGAAAGCGGAAAGTCATGGCACCATCAATC
GTGCTCTGACCAGTATGTAAAAAATTTCTTAAGCCTCACCATGTTACAGATTGGCCAGAG
CATCTGGATATTCACCACACCTGATTGGGAAGACTCATAGTTTTATGAAAGATTTCTTCA
GAAAAAATGACATGCTGATTTTGTCTACTTGCGTGTGCTTTCAGTTCTTTACCAGTACGA
TTTGGTCACGTGACACGCGATCAACTACATTCAATCCATCTGCCCCTTGCTGGTTCCGAG
TATCAATTCTAAATTGTGGCTACCACTATAGCAATAGTACGCCAAGCTCGGATGCAAATC
ACGGATATCTTCTTAGCATCCGAGTTCAACATCCGAGTTCAGCATCCGAGCTTTGCGGCG
AAAACTTAACAAGATAACGGATAATCAAAGTTCTCTGTGATGTTACGGAGTCTTTGGTCT
GCGCTGCTGACTAAAATAGTGTGACACAACGTACATAGCGCCACCCATATTGGCCGATAA
GGACCAGACTTGTGGCGATGACTGTTAACTCTCCGCGAATCTTTTTCGAAGTCGCAGGTG
GCATTGCAGAAACAAAAATGTGTGGCTTCTGAAAAAAAAAATAGGCACCCCATTTGATGT
AAGACATCTGGCTACCCCTTGTACATTTCAGTCACTGAGCATCGAAGGCACGTCTTTGCA
GCATGCAATAGTGTTCGAAGTTCTTCCATTTACGGTGGCTCCCCTCACTGGAACGGTGAT
GTAATATGTAGATAGCTAAAACATTTCGCAGGTCCCTAGGAACTGGACGTCAAGATGAAT
AGGTATTGTTAAAAATGCGTACCTGTTGAATTGAAGAGGTCGGAAAAATCAAAGTACTTA
AACAGACGATTGATTCGACATTTAGCTATTCAGGTTGCACTTCTTGAAGGTTGAACAAAA
CATCAAGAGAAAATAAAAAAGAAAATATAACAAAAAAGAA
Chr coordinates Chr XII from 30109-31704
w3c xhtml validator w3c css validator