Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MHT1
Systematic Name YLL062C
Strain S288c
Description S-methylmethionine-homocysteine methyltransferase; functions along with Sam4p in the conversion of S-adenosylmethionine (AdoMet) to methionine to control the methionine/AdoMet ratio
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MHT1 YLL062C
CAATTTTGAAAATTGACATATAAAACTCTGATTCTGCAAAGCCTCTTGCCCCAAAAAGAT
TCAATAGCATGCTTAAAACGAACGCGATTGCAACCCAGGCAGCAGGATTGACCGATGGTG
CCCAATAAGAGATGGTAAGCGAACATCCTACCAGCTCGCTAGGGTAAGATATGAGCCACA
TCAATAAGTAGTTAATTCCTATACTGAAGCCGACTGATGGGTCTATAAATCTACTGGCGT
GCAGCGCATAGGAGCCGGAAACAGGGTACTGACATGAAAGTTCGGCCCCACACTGAACAA
CACAGAGCATAGATGCGCCGACCAACAAGAAACCAATTAGCAAAGAAGCAGGTCCGGACG
CTAGTGATTCCCCTAAACCAATGAAAAGACCCGTCCCTAGAGTACCTCCAATGGCTATCA
TGGTCAGGTGTCTTTGATCTAGGACCTTTTTATACGGCTGGTTGGCTAAGTCCCATTGTA
TTTTTTCTTCCTCTGAAAGCTCCGAATACAGCAAACCTTCTTGGATCGCTGGTGAATCAT
TTCGCTTGAAAGAGTTCTTGAATCTGTGTATTAGATTATTTCCTTCATTCGAAGGCGTAC
TTAACACGCTAGTGGAAAACTGAACCTTCGAAAGTTTGGTAGATTCAAATTCATCCATTT
CGGGTATCTTTCATGGTATCCTGATGGAGAACTCTTGACGGTGATTACTTAACCACCCAA
ATCTGTAAAATATATACGCATTTATTTCCTGGCATCTCTTCGCTATCCCCGCAAAAAGTT
AATGAAAAAAAGCCATTCCTGCAGGAACTGTGGAAAAGTAAAAACTGTGGCATGAAAGTA
CTACCAAATTGTGGCGAGGTATTCAATGGTAATAGCAAAACAGCAACAACGCCAATTTGA
AAATGTACTACTAAGGAAGATAATTTAAACAGACAAGTTGTAGAAGAAATCTGAATCAGC
AACTTTTAGTGTGCAACTTGAAAAAGTAATCAAAAAACAG
Chr coordinates Chr XII from 17613-16639
w3c xhtml validator w3c css validator