Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YLR001C
Systematic Name YLR001C
Strain S288c
Description Putative protein of unknown function; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies; predicted to be palmitoylated
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YLR001C YLR001C
ATGAACATGGCAATCCAAACAATTAAATACATTTTTTGGCTACTGCCGATATTAGGGCTT
ACACAAGCACTTCTACAAAACCCAGGGGACGATTTTCCATTTAGCACAGTAATAGATATC
CTCTCAGAAAATGTTGAATTCTCAACTTTTTTAAGGATTATTCAGAAAACTGGTCACGTA
CAGTACTTAAATGAGCTACAGAACTTTACACTTTTTGCTCCGATTAATTCAGCATTTATT
AAGGGGGACCAAACCACAGACCAATTTGAGGAGCATTTCCATATTGAAGATTTCCTTATT
CATGATAGGGTATTGCAAGTGAGAGACCTTGAAAACGGTACCTACCTGGAGAAAAGAGCT
GCAAAAGCACCTTTATTGCTGAGAAAGCATGAGCGCCATTGCTTTGTCAATGAAATTGCT
GTTGTCGAACCCGATTTGCTGCCTAGTTTCCAGAATGCTTCATTACAAGGTATTAACAAT
CTTTTACTAATTCAACCTCAAATAAATGAGTTGCTGGTACAACTAGATGAAGAAACCCAA
GATTTAAAGATATTTAGTGATTTTATCAGCAGTTTTTCAAACTATAATGCATATACAAAC
TCATCCACAGTTTTAGTGCCCTTAGATGTTAATTTTCGAAAATTCTTCAATACAATCGAA
ATAAACTATCTACTTGACAAATATAATAAATTGGGTAAATCTAATACAATTTCTCAGGCC
AAATGGGCCGCAGATAGAACTTCCCTTCTTCAAGAACTCATTATTGATGACGTGTATGGT
GGTATTTTACCCAAGGAACTAATTTTAGAAAATAAAAACAATCGAAAACTTTTTATGAAG
AGTAATTCAGAAGGTACATCAGTAAGTGTAAATAATTCAGATTACTCACCCATATCAAAC
AGAATTTTTGAAATAGGCGTCGTGCATGGATTTTCTGACTTAGACTTTTTACGAACGCAT
ATACAGTTTGATGCTGAAAAGTACTTGCACGGTTTGAACTGCTCAGAATTCGTAAAGGAG
TTATACTTCAGAGACCTTGAAAAATTCATTCAAAACGGAAGGAAAATCACCATATTTGTA
CCACAAGCCTCTTTTAATGAGGATCGTGGGTACACAAAACCATCACTTCTGTACCATTTT
GTAGAAGGTAAAATTGACCTTGAACAGGACTTTTCCTCATTGCGCCCGATTCAATACGCA
CCTACCCAAATTTATGACTCCGCCTTTTGCTCTTCAGCTAAAAGACTAGGTGGACACTGC
CAAAAGTTCAAAATCACAAGGTCTAATAAAGGTTATTACATCAATGGTCGCTTCAAGATT
TTAAACACAAAACCTTATGAGATTGGTAATACGTCCATTTATTCTATTGACGATGATCTT
CAATTACCGGGCGACTTAGTGTTGTCATTAGCACCAGAAAACCACTGTTCTATTTCCCTA
ATGCTCTTGAAGGAACTTAACCTTTTGGATCTACCATCAAATCATAAGGGGTACACGATA
CTTCTTCCATGTATGAATTCATGGGACAATAATGATTTGACTATAGACTATTTGAGGTCA
AACAAAACCGCCCTAAATTTACTTATGAGGAACCTAATCTTCGAAGACCTTATTTATTCC
AACAATTATAGTATTTCGACTACTGTCAAGAATTTATACGGAAATTCTGTATCTATTGGC
GTACAAAAAATTGTGGGAAGCCAAAACCTTACGAAAATCTCAGTGAGTACTATAAAGGAA
AGTATTATTATTGAGGAGAGTTCCGATATATTTTTCAACCAGGGAGTTATCCATCCTATA
GACCAATTGGATTTTCCAGTCGATTTGGAGATATCCCTAAAAGAGCTGATAGAAACTACT
GGAACAAAAGAAATATTTGACTTTTTTAACTTGTTTTATGACCTTTCTTCAATCATTTGG
AATAACGAAGAGTACTCGCTTTTAGTTCCAACGGCTTCTTCTATTCCATTAAGTGGCATC
ACGGCGAACTCGACAAACTTAAGAAAATTCCTCGAACTCCATTTGATTCCTGCTAATGTA
ACGCAAAACCTACTAGACTGCAATGGCTCCATTAGCACTAAACTAGGTACAAAACTAAAC
TGCAGAAAAGATCATCTGGACAACGTTTTTGTTAGCATACAGGGCGACTGGACCAAGGAA
GTTAGAGTTCTTAAAACAGGATGCACTACTAATTTGAAAAGTTCATGCATATTTCTGATC
GACAAACCCATATCCTTATCTTGGCTAAACAGCGAGAAATACCATCTGCGCTTGCCAGGG
ATAGCGGTTGGATTTGGGGTTATAATAGGTGTTACCATAGCCATTTCTTTATTGTTTTGC
ATAATAATTACCAGGGGTGGAAAAGTAAAAGACAAAAATCAAAGAGGGAGAAATGATCGA
GCAACAACACCACTGATTCAACACTCTCCGATAATCCACAACCCTTCTTACTCGGCAACA
GCGCATTTATCACCACTTTCTCAACCCACTTTTGAAGGTTCATATTCTGTGAACGCTATA
CAAACCCCCAGAGATATACGAAGGGTGGGATCAGATCAAAAGGGCGGTCGCAGTGTCAGT
ACCTCATAA
Promoter Sequence
Download FASTA
>YLR001C YLR001C
AAGAACTTATTAGTGACACTGAATTCGATAACCTTTCCTCTGCTGAGGTCCGTAAGGCTT
TGCTTTGTATCGTTAGTGCATTCTCACTTATTTCAAATACACAATATATGAAAGTTAATG
TGGATTTGTCCAAATTCGTCGATGGGCTTTACGCGCTATTACCTTATATCTGTCTTGATG
CAGACATCGAATTATCTTATAGATCGCTAAGGTTGGCTGACCCACTCAATAACGAAATAA
TAAAACCATCAGTTAACGTTTCTACCAAAGCAGAACTTCTGCTAAAGGCTCTGGACCATG
TATTTTTCCGCTCTAAATCAGGGACTAAAGAAAGGGCTACGGCGTTTACCAAAAGATTGT
ACATGTGCATCAGCCATACCCCAGAAAAAACAAGTATTGCCATTCTTAAATTTATTGATA
AATTAATGAATAGATATCCAGAAATTTCAGGCCTTTACTCTTCCGAGGATAGAATAGGCA
ACGGTCATTTCATAATGGAAGCCGATAATCCTTCAAGGAGTAACCCAGAGGCAGCAACCT
TATGGGATAATGCTCTTCTTGAAAAGCATTATTGTCCTGTAGTTACAAAGGGGCTACGCT
CTCTATCATCTAGATCTAAAGAGTGTTCTAAATAGCTAGATCCTATATATTAAGTATATA
AAGAGCCACGATTATCGTTAGCCAATCATTTTTGCCGTGTCGAGTAGAATTGTATAAATA
TTAGCATTGTATGAAATTTGAATGAATTACCGCAAAAGTATTATACGTAAGCAATAGAAA
CAAATATCAGATTCAAGTTCACCAAATCAATATTAACAGCTTACTATATTGTCTTTTTTT
ATGGAAGAACATTACCGTGAAAACCCGGTAGGAGAATTTTGTTCGGTCGGACTTCCCCAT
TAGGCGTATATTAAGGGCCTAGAAAATAAGACAAAACGGCTTCTTATCTAAGCTGCTGTG
AGTGACAGCATGTATTAACTGAATCAAACGGAGCCCTTTG
Chr coordinates Chr XII from 153977-151389
w3c xhtml validator w3c css validator