Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name THI73
Systematic Name YLR004C
Strain S288c
Description Putative plasma membrane permease proposed to be involved in carboxylic acid uptake and repressed by thiamine; substrate of Dbf2p/Mob1p kinase; transcription is altered if mitochondrial dysfunction occurs
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>THI73 YLR004C
CGTACTGGATAATCATGGCATGCCTGTTTGGTCTCAAATCCTTTTCCAACATAGCTTCAC
TACAATCTAGTGTTAATATTAAACTTCTGATAATACCTCTTTGGTATGGCGTTATGTTTT
TCTTAGCAGTACGTTTCTTTCTGGCCTCGACTATGCTAGCCACAAGAGATGCCATATCCC
CTTCATCGTCCACTTTCACCAAATCCCAACTTCTCTTGATCTCATCCTCCCAAGCGTACC
CACCATTTGAACCTTGCAGGTTTCTATTCGAGAGCCTTTTCTTCTTCTTACGCTGCACAT
GTTTATCCCTATCCCTGTGGCTTGAACTGTGCTGCTGTTGCTGTTGGTCTACACGATCAT
CTCCCTCGCCATCAAAATGAACTTGTCTCTTAGTTCTTCTAGTAATGGCAACTCTATCCT
CATCCTCTTCAGATTCTGAAATAACTACAGGAGCCATTCTACTGCACAATCCTTCCGCAC
ACACGCAATTAGCTGCCGACTTGCCCCACTAGTAATCACCTGCATCTATATAAGATAAGA
TGAAGACCTTTTACGTATCTTGAAAAACTATACAATAGCAAAGAAACCTACCACCCAGAC
CCTGTGCGGAGTATCTCGAACTTCCAGTATATTACTCTCAAGTAGATGACGCGTAATAGA
CAGGTTTTATTGGCAAATTTCGAGTCGCTATCATTATCAACATTAATTATAGGGTGGTGT
TTGGTTGGTTCGAGTGCCGTCATAACTATTTGTTTTTTTTGCATATCTGGTTGATCCTCC
TTAGTTAATATAGTCTCTTTGAGTTTCCCTTAAGGAACTGTCATTTGGTCCGGCGGAAAA
CATGGTGGTGACAGACAGCCTTTTCAGAGGTGATGAGCAATCTCGATGAGCATCTCAGCG
GGTGCATATATACACGTATATAAGATAGTTCAAAGTATGATAGATTAAAGTTTACTTTGT
TGTTGCTGAGAAGTAGTGAGAGTGTCAGCAAATCAATACA
Chr coordinates Chr XII from 159505-157934
w3c xhtml validator w3c css validator