Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YLR042C
Systematic Name YLR042C
Strain S288c
Description Protein of unknown function; localizes to the cytoplasm; YLL042C is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YLR042C YLR042C
TTCTCGAGCATTAGATGATTAAATCAAAATGACATAGTATTTCGCAACCTTTCAGTTGGG
CTTTGTTTAAGAAGTGGAATACTTTTGCTTGAGTTGTTTAGTTTTATTTTATCCACTGTT
GTCTTAACAAATATTTTCAAGACCGGTAAGCCGAAGATGAAAAATCATTATTAACTCATT
TTTTGAACAAAAATATAAACAAAAGAAAGGCAACGCACAATTTTAGAGATACATAAAACG
CAGTGGATGTTAAAAATAACAGCGGTACAGAAACGCCTGTCTCGCTCCAATAATAATTAT
ACAAATTTGAAACCGAACGCAATGTGCCAAGAAATGTAAACACACTATAGAAAAAAATAG
AACGGTGCACATTGTGCTAGCATATCTGCTTGGTTCTGAACAAGAAGCACCTGGCCACTT
TCTCCTAGCCCAATTCTTGCCAAGTTTTCAACCTCAATCTTTTGTGTTTGAACAAGCATG
TATGAGGGGTCAAAATTTAGTGGAGGCCGCTTACAATCCTTCTATTTCCTCTGGACCTCA
TTAGCCGTCTGGCCAGACCTAAGCGTCATAATCTGGAGAATTTCATTGCATGCGAGAATA
TGATAAGTAAGAACTTGTTTATTTATACAAGTTCCACCCACTCATACACGGCTACAATTA
TGACGTATAATAACGTTTCGTCTAGCCCACCTTTTTTACTTTTGACGTTTTATTTCTTTC
GAGGATTTGGCCAAGAATGCCCCGAACAGCGGAAAAAATGGCGTCGCAGTTTCAGATGTA
TAGACTCATCTTGTAGAAAAAAGAATGCAAGAATGAAGTCTTTTCGTGGTGTTTTGAAAA
CACTATAAACAAACCGTCAACAAACATTTTGTATAAATATTTAGCTATATATTGAATATC
TTGACCAGTAAAGCACCTTGAGAAATTGTAAGCTTGAAGAACGTACTTTGATATCCCTCC
GTTTCATCATCCTATAGCTCGTCAACAAATCAAAAAAAAT
Chr coordinates Chr XII from 230451-229966
w3c xhtml validator w3c css validator