Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPS0B
Systematic Name YLR048W
Alias NAB1B, S0B, S2, uS2, YST2
Strain S288c
Description Protein component of the small (40S) ribosomal subunit, nearly identical to Rps0Ap; required for maturation of 18S rRNA along with Rps0Ap; deletion of either RPS0 gene reduces growth rate, deletion of both genes is lethal
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS0B YLR048W
TCAGTTAGCAACAAATAATTCATTAAGGGTATAATAACACATATTATAATGAAAGAAATT
AAAAGACATATCTGAGAATATTTGCGGACTCTTAAAGTTCTAAAATGCTTGTCCACGTCG
ACATCAAAACTGGGAAGATGTTCCTTGAACCAGCTAACGATGGACTTTAAATTCATGCTG
AAAATAACAATAAATAAAATACAGTAAACTTTTTTAGCGGAACTTCTATTGTAATTTAAC
GATTTAATCTGAAGAGATGTAGATGTAATAAAACTGTTAAAGTGGCAACGTGATAATTAA
AAGCTTGGCAAAAATAAGAGATCAACACTAGCTTTTTCTTTTTCCACCTAAATTTGAAGG
GAAATAAAAAAGAAATTGAGGCTGTACAGAGTGTTAATCTTCCATAACGGATACCACCAA
ACGTTTTTACCCTAAACTTAAATTTTATTACTTATTTTACATGCATAATGGCTGCCATGC
GTAGTTCATACATGTTATTTGCACCCTTTTTCTTTTTCAATAACAAAAAAGAGCTTGGGC
ATTACGTTTTCAACACTTTTAATATTTCCCTTTTTACATCCGTACATATAAAATGTAAAC
CCATGCATTCATGACAATTTTACCTATTTCTTAAAGGCCTTTGTCACTTCTTTATGGGAA
TGGCGCTACTTTAATTTTCCGCCTACTTTGAAAAATTTACCAAGGCGAAATTGAGTGCGC
TAGGCGGAAGTTCCAGGGCACGGTCACCGAACCTTTGTGCTGTTTCGAACGAGGGTCCCG
CTGGAGGTTGACGGACGCGGGAGGAGCTGGAAAGATGGAATGGAAGGACTGCAACACTCA
GTAAGAAGGTTCGTGGTAGGGAACATCACCTTCTCTAGTTCCTGTAAAAATAATATGATC
AAGTTTGAATCCTCGTATTGAAAAATCGCGAGTTATTAAGTGTGTAATTTAGAATACCGA
AATAGCACAAGAAGAGATAAGATAAGATACTGATAGGATA
Chr coordinates Chr XII from 242232-242321,242681-243349
w3c xhtml validator w3c css validator