Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MLO50
Systematic Name YLR049C
Strain S288c
Description Mitochondrial protein of unknown function
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MLO50 YLR049C
AGGATACGAATTAGTAGGTATAAAAGGAACAACCGCAGCAAATAAGTACGAGAAACGAGC
CACTCACGTGAAAACATATAGAGAAAAGCGACCGGAGATAATGAAGCTAGGACATCGTGA
GCAACAATTCTACTTGTGGTACTTCATCGTTCACATTCCCATCACCATATTCATCGACTC
ATCAGTGGTTATTCCCGCTAAATGGCAACTAGGGATTGCGCAAAAGGTTGTTAGTGATCA
CATCGCAAAGCAACACGATTTCCTGCTATCAGAGAAACCAGAATGGCTATACTGGTTTGT
AGTCCTTGAGCTAGTTCTGCAACTACCCCTTTTCGTCTATTTCGTCAATAAATTCTGGAA
TTCAAGCGAATTACAAGTTAATACAAATAGCAGATTGAAAAAGTGGTTGCGTATCTATGG
CTGGAATGCCTCTCTAACTACCTTGATATGTATCGTTGTTATTTTCAAGCGTGGTTACAT
TCCTTACGATGTGCTAAAAACAAGCTTGTCCATGACCCAGAAGTGTCAGTTAGCCTCGGT
GTACCTACCTACATTCCTAATTCCTTTGCGTTTGTGTTTTGTGTAGCCTGTGTCGGCTAT
ATATACAGTATTAGTGACTATATAGTTAATTAGTGACATATGCCACTAGTTTTATCTAAT
TATTGTGCTGCGTTTTGCAGTATTCTTTTTTATTTGAAACGCGTCACAAAAGTTTCGCGT
CCTTAGGGAAATGGCTGGTTTTTGTTTTAAAATAGTATATTATCCTTGATGTAATTTAGC
AAGAGTGTATTGTAAGGGAACAGTCTGTTACTGCCATTCCCTCATCGCTAGATCCCCCTT
CCCTCGCTTATTCCGTTACTTTCGCTTTACTGAGCCATAACCAAGCGCACGCATACATAT
ATATATATATATATATTGTGCTGCACGTATATATAAATAAATCACGCGTACAAGGATACG
TTAGCCAAATTCTTTGGATATAACAAAACAGCTACAACTC
Chr coordinates Chr XII from 245172-243886
w3c xhtml validator w3c css validator