Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YLR053C
Systematic Name YLR053C
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YLR053C YLR053C
AAGCAGATACAGGCTACGATGATAAACACTTGCCTGATGATACGATACATACATTTGAAG
ATGAATATTTGGCCGATGAAGACGACTTTTCTTGCCTTGGAATTGACAAAAGAAGCTCAA
CAAAGCCCACAAAGCCTCTAGAAAAATTTGGAGTGGTTGCTGTGCCACACTTCATCAGGA
GGTTTTCTATTAAAAGGTCGAGTAAGGATAAATCAAATGATATGAAAAGACCATATACTA
CAAGCAGCTTGGAGTTGCAATTAAGGTCAAATCACTTTATGTTCGCCAAAGAATACCAAG
ACTTACATAGACAATTATATTACGAAGTTAAACCAAGGACGCAATCAGAATTGGACGCAA
GACGTCGAAACTATTCTGAATTAGAATCTCAGATGTGGAAAATTAAACATCGGTTCAATA
TTCATAGAGGAGCACTGCCTCGTCCACGAACGAATCCGTATGAGCTATTACTGGACCACA
TTGATGTTTTGAACCGTGGCAACACTGGGGATATTTTGAGATTTACCACTAGTAGATACG
GTGGTGTAGATACGTATGATTCCATCTTGAGGGACCAATCCACGATCATGGAACTTTTAG
ATAAACGGTGTGCCTATTCACCTCCAGTACTGTTCGATAATGAGGCTAAAGAACGTGATC
ATGATCGCGATTGTTATCAAGATTACAATCACGACCACCGGAGTCATTAATATTAAAAAA
AAAAAATGTGATTGTTAATAAGGGGTGGGATGCGCGAAATTCTATGCCTACAGTAGAAAG
CGGTTGTTGCACAAATGATTAAATCTTTATCTCCAACTCACAATACTATCGCGATAGATG
CATAATATGTGCAGCTTCTAAACAGCACGGAGTGATGATAAATACGCATATATGTATATA
TATATGTATGTGCATATGCACGTCCTTTTAAAACTCAAAATACAACATTCTTAGTAAATC
CTTTTGTTGACACACGTCGGAACAACTCAGGACGGAGTTA
Chr coordinates Chr XII from 248426-248100
w3c xhtml validator w3c css validator