Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name OSW2
Systematic Name YLR054C
Strain S288c
Description Protein of unknown function proposed to be involved in the assembly of the spore wall
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>OSW2 YLR054C
ATGGAAGAAAACCAATTAACGTGCTTAATAGTTGGAGAAACACCAGCAGCACAATTTCTA
GGATGGAGACTAAGTTTGAGCAACTCTTTTATAATACTGGTCTCGCAATATGTGTCTAGT
GACGAGTTAGTTGCCTGGAAATCGACAAAACTAGGCGCCAATTTCTACACGCCAAACATT
CTCACTAAGGATATTAAAGAGCTGCACCACAAATTAAAACATAACGGTGCAAATACGTAT
TCAATTGACATTGTGTTAGTGTCTGCAATTTCCTTACAGTCTTTCGAAACAACTTGTCGA
TTGTTGTCAGATTACACGAACGACAATACGACTGTGCTTATTAGCACTGATTTTGGTTGC
GAACTGGAGCCCATAGCCATAAGTTATTTTGGAGGGAAGTGCAAGTGTGTTATTTCCATT
TCGTGTGAGGTTGAATGCAGACAGTTATCGCTTGGATCATATGCATTGGTCAACGACGAT
CAATGTGTAATAACTTTGGGATTAACTTATTGTGATGCTAATTTTGAAGCAAGTCCAACC
ATTCTGGAAAACACGAAAGCAGCTTCGTTAGAATTGCAAGGGATTAAGGGTTCAAATGTT
CGCAGGTTCCTTCTTGGATTGACCGTTGCGAAATGGATGAAATCTAAATTAATTTTGGAC
CCAAAACAAATGGCATTGAAAATGTGGGAATTGCTTATTCCTAAAATCTCACTTAACATC
CTTTCTATCATCTATGAACAATTTGATTATGAGAAAATGTTAGAAAACAAATCCACAGAA
ATTATTTTTAAAGATCTGGTGAAAGAGTTACTTGGAATTTGCTTTGCACAATGTGGAAGC
AAAATTGCAAGGTTTTTGCTAGTAAAATCACAAGGTGAAGAAGAGATTAATTTTGGGAAA
ATCGTAGAATATTGCAAAGGTAAAAAACTGCAACTTATCAACTCTACGGCAAACGAACAT
CCGGAATATTTATCCTTACCGTTTGAGCCTTATTGTTTCTACCACCGATTTGAATATCCT
GCTCAAATTCTTTTGCATCAGCCCATCATTTTGGCCAAAAAGTATGGTGTTTCGTGTTCA
AATTTAAATTTCCTATATGGATTCTATACGAGGTTACTGACACTAAGTGGGCTATCAATA
AATGGTGGAAGGTGTGAGCATGCCTTGTCGATGTTGGACAGCAGGATTGGTGGTGGTATT
AACGTTGCTTCAGGAATTAATAGCGGCCAAGATTTTACCGATGGTGATAACGAGGATCAA
GATAAAGGCAAAAACAGAGTGGACAAAAATGTAAAGGAAGGTTCTTTCATTAGTTTAACA
CAACGATTCACGATGACAAGTCCACTGGGTGTCAATGATCCAGCTTTACCAGCGGACTTA
GAAAAGTTGTATTTAGGTGCAGAATACATTAGCAATTGCGACGCAAATACATCTGGTGGT
CAAAAACGAGTAAAATCTCCAACTAAAGCAGATACAGGCTACGATGATAAACACTTGCCT
GATGATACGATACATACATTTGAAGATGAATATTTGGCCGATGAAGACGACTTTTCTTGC
CTTGGAATTGACAAAAGAAGCTCAACAAAGCCCACAAAGCCTCTAGAAAAATTTGGAGTG
GTTGCTGTGCCACACTTCATCAGGAGGTTTTCTATTAAAAGGTCGAGTAAGGATAAATCA
AATGATATGAAAAGACCATATACTACAAGCAGCTTGGAGTTGCAATTAAGGTCAAATCAC
TTTATGTTCGCCAAAGAATACCAAGACTTACATAGACAATTATATTACGAAGTTAAACCA
AGGACGCAATCAGAATTGGACGCAAGACGTCGAAACTATTCTGAATTAGAATCTCAGATG
TGGAAAATTAAACATCGGTTCAATATTCATAGAGGAGCACTGCCTCGTCCACGAACGAAT
CCGTATGAGCTATTACTGGACCACATTGATGTTTTGAACCGTGGCAACACTGGGGATATT
TTGAGATTTACCACTAGTAGATACGGTGGTGTAGATACGTATGATTCCATCTTGAGGGAC
CAATCCACGATCATGGAACTTTTAGATAAACGGTGTGCCTATTCACCTCCAGTACTGTTC
GATAATGAGGCTAAAGAACGTGATCATGATCGCGATTGTTATCAAGATTACAATCACGAC
CACCGGAGTCATTAA
Promoter Sequence
Download FASTA
>OSW2 YLR054C
GTAACGTCAACAGTGGTAAAGAGAATGAAAATGCAGATGACGATATGGATTCTCTGTTTG
GTGATGAAGACGAAGACGAAAAGCAAGATGCTGGCAACGAACCCGTCGAGACGGGGGATG
GTTCTAATGGTGAAGAGAACAAAGAACAGATATCTGAAGAATCTTTGAACATAGTCTATG
ATGAATCCGTTTTTATGACCTCAGGGTTGAACGGTTCCGTGCATATTTGGGACCGACGCA
TGACGCAGTCGCCAGCATTGTCTCTGGAGAGAGGTGCAGGCGTCCCACCGTGGTGTTTGT
CCGCATGTTGGGGTGTAGATGGTGATCATGTGTATGCAGGGAGAAGGAATGCCTGTGTGG
AGCAGTTTGACTTGAAGATGCCCTCGAAACCTATCCATAATTTGAAACTGCCTTCTATTT
CAGGGCCTGTCTCTTGTGTTAAAGCCATGCCTAATAACAAGCATTTACTATGTGCATCGC
GGGATAATATCAGATTGTACAACGTTGAAATTGCAGTAGATGCTTCGAATTCGACTACAA
AGAGTTCTAAAGTGCCGTTCCTCATCGTGCCGGGCCATCACGGTGGTATTATATCAAACT
TATACCTCGACCCCACTTCAAGATTTATAATAAGCACAAGTGGCAACAGAGGCTGGCAGG
GGAATTCTACGGACACGACCCTTATTTACGATATAGACTTAGAATAGTGAGTTGTAATAA
TAATCATAACCATAATCATAATCATAATTACTCCGCGCGCCGTTTATTTTTTTTTTTTTT
TTTTCAGGGCCACTGATCCCTTCATTTTGTGTCAGTAATTCAGGGTCCGGGCAGACAAAG
GCATATTATACTATCAAAATTTGAATGAAAAGTAAAATGAATGGAGTTAATAATACGCTT
CATATTAACAAAAGCACATAGACGCACGATACAAATACTAGTTCAAATTGTATTCCTAAG
CCTTTCTTTCTTTTTTTGAAGGCAAGAACTCGCATTAGTT
Chr coordinates Chr XII from 250860-248717,250978-250948
w3c xhtml validator w3c css validator