Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SHM2
Systematic Name YLR058C
Alias SHMT2
Strain S288c
Description Cytosolic serine hydroxymethyltransferase, converts serine to glycine plus 5,10 methylenetetrahydrofolate; major isoform involved in generating precursors for purine, pyrimidine, amino acid, and lipid biosynthesis
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>SHM2 YLR058C
ATGCCTTACACTCTATCCGACGCTCATCATAAGTTGATCACCTCTCATTTGGTGGACACC
GACCCTGAAGTGGACTCCATTATCAAGGATGAAATTGAAAGACAAAAGCACTCCATCGAT
TTGATTGCTTCTGAAAATTTCACCTCAACCTCCGTTTTCGATGCCCTTGGAACTCCATTG
TCCAACAAATACTCTGAAGGTTATCCAGGTGCTCGTTACTACGGTGGTAATGAACACATT
GACAGAATGGAAATTCTATGTCAACAAAGAGCTTTGAAAGCTTTCCATGTTACTCCAGAC
AAATGGGGTGTTAACGTCCAAACTTTATCTGGTTCTCCTGCTAACTTGCAGGTTTATCAA
GCTATTATGAAGCCTCATGAAAGATTGATGGGTCTATACCTACCAGATGGTGGTCATTTG
TCTCACGGTTACGCTACTGAAAACAGAAAAATTTCTGCTGTTTCCACATACTTCGAATCT
TTCCCATACAGAGTTAACCCAGAAACCGGTATTATCGACTACGATACTTTAGAAAAGAAC
GCCATCCTATATAGACCAAAGGTTCTTGTTGCTGGTACTTCAGCATACTGTCGTTTAATT
GACTACAAGAGAATGAGAGAAATCGCCGACAAATGTGGTGCTTACTTGATGGTAGACATG
GCCCACATTTCTGGTTTGATCGCCGCAGGTGTCATCCCATCTCCTTTCGAATACGCTGAT
ATCGTTACCACCACCACTCACAAGTCTTTGAGAGGTCCACGTGGTGCTATGATTTTCTTC
AGAAGAGGTGTGAGATCTATCAACCCTAAGACCGGTAAGGAAGTTCTATACGACTTGGAA
AACCCAATTAACTTCTCTGTTTTCCCAGGTCACCAAGGTGGTCCACACAACCATACCATT
GCTGCTTTGGCCACTGCTTTGAAGCAAGCTGCCACTCCAGAATTCAAGGAATACCAAACT
CAAGTCTTGAAGAATGCTAAGGCTTTGGAAAGTGAATTTAAGAACTTGGGCTACAGATTA
GTTTCCAACGGTACCGATTCTCACATGGTTCTAGTATCCTTGAGAGAAAAGGGTGTTGAT
GGTGCTCGTGTTGAATACATTTGTGAAAAGATTAACATTGCTTTGAACAAAAACTCTATT
CCAGGTGACAAATCTGCTTTGGTTCCAGGTGGTGTCCGTATTGGGGCTCCAGCCATGACC
ACTAGAGGAATGGGTGAAGAAGATTTCCACAGAATTGTTCAATACATTAACAAGGCTGTA
GAATTCGCTCAACAAGTTCAACAAAGCTTGCCAAAGGATGCTTGTAGATTAAAGGACTTC
AAAGCCAAGGTCGACGAAGGCTCTGATGTTTTGAACACCTGGAAAAAGGAAATTTACGAC
TGGGCTGGCGAATACCCATTGGCTGTGTAA
Promoter Sequence
Download FASTA
>SHM2 YLR058C
CAAGCTGTTCAAACCCTTGGTCTGGATCGACTGCGAGATGACCGGTTTAGACCACGTGAA
TGACAGAATTATCGAGATTTGCTGCATCATCACCGATGGACACCTGGCACCCGTCAAAGC
GGCCGATGGCCAAGGAGACTCGCATTATGAGAGCGTCATCCATTATGGTCCCGAGGTGAT
GAACAAAATGAACGAGTGGTGTATTGAGCACCACGGTAATAGCGGTCTCACCGCCAAAGT
TTTGGCAAGTGAGAAGACTTTGGCCCAGGTAGAAGATGAGCTGCTCGAGTACATCCAGCG
CTACATCCCAGACAAGAACGTTGGCGTCTTGGCAGGCAATAGTGTACATATGGACCGCTT
GTTCATGGTCCGCGAGTTTCCCAAGGTCATTGATCATCTCTTTTACAGAATAGTTGACGT
CAGTAGCATCATGGAAGTTGCCCGCAGACACAATCCCGCTTTACAAGCACGTAATCCAAA
AAAAGAAGCTGCCCACACTGCTTATAGTGATATCAAAGAGAGCATAGCTCAATTGCAATG
GTACATGGACAACTACTTGAAGCCACCACAGGAAACAGAGTCGGTCGAGTCAATCGGATC
TGAACAGCCGGAGTCACCATCTTCATCTACCTCATCTTTGAAAAGACAACGCACCGATTT
TTAATGTAGAAAAAAAAAAAGAAAAAAGAAGTGAAATTTTTCAAATATTTCACACACGAA
ACATGACTCCTGGTGAGAAATGACCCTTTCAGGTTGCTTTGACCATAAAGGTTTGACTCT
ATCTCTTGGGTTTCTCATGTTCGCTTTTTACTCTGTATAATTTTTAAATTCATAATCATC
TTAGACCGAACCATGAGTCTTCTTCATCTTGTTTTATATATAATGCAGAACTTGCTTCCC
TTAGTTTGCGTTCAGTAATCTTTCCTTCTTCTAGTGTAACCTTTACGAAAGATACTACCC
CATAGCAAAGCATAACAGCTTAAACCGAATCCTCCTTAAC
Chr coordinates Chr XII from 259401-257992
w3c xhtml validator w3c css validator